The Pacific oyster Crassostrea gigas contributes significantly to global aquaculture; however, C. gigas culture has been affected by ostreid herpesvirus-1 (OsHV-1) and variants. The dynamics of how the virus maintains itself at culture sites is unclear and the role of carriers, reservoirs or hosts is unknown. Both wild and cultured mussels Mytilus spp. (Mytilus edulis, Mytilus galloprovincialis and hybrids) are commonly found at C. gigas culture sites. The objective of this study was to investigate if Mytilus spp. can harbour the virus and if viral transmission can occur between mussels and oysters. Mytilus spp. living at oyster trestles, 400–500 m higher up the shore from the trestles and up to 26 km at non-culture sites were screened for OsHV-1 and variants by all the World Organization for Animal Health (OIE) recommended diagnostic methods including polymerase chain reaction (PCR), quantitative PCR (qPCR), histology, in situ hybridization and confirmation using direct sequencing. The particular primers that target OsHV-1 and variants, including OsHV-1 microVar (μVar), were used in the PCR and qPCR. OsHV-1 μVar was detected in wild Mytilus spp. at C. gigas culture sites and more significantly the virus was detected in mussels at non-culture sites. Cohabitation of exposed wild mussels and naïve C. gigas resulted in viral transmission after 14 days, under an elevated temperature regime. These results indicate that mussels can harbour OsHV-1 μVar; however, the impact of OsHV-1 μVar on Mytilus spp. requires further investigation.

Shellfish culture, based on ecological and market assessment, is considered a driving force for socio-economic change in ecologically complex coastal systems such as lagoons throughout the Mediterranean area. To diversify fish production, the Pacific oyster Crassostrea gigas was cultured at commercial farms in the Varano Lagoon (SE Italy). The aims of this study were to evaluate through four condition indices (CI, CICG, CIE and AFNOR index), the Polydora index (PI), lipid content, quality and market aspects of oysters reared at two different sites (FO and LA) of the Varano Lagoon, which are characterized by different hydrodynamic conditions. The results of this study highlighted the potential economic benefits associated with sustainable aquaculture development in the Varano Lagoon, proving that the area surrounding the LA site was more suitable for oyster culture, reaching commercial size (60 mm) in a shorter time (6–8 months). Higher growth performance of oysters was observed in the spring, when the nutrient availability positively affected the feeding response of suspension feeders. The opposite was found in winter and in summer, when the decrease in growth could be due to the reduction of nutrient and to the increase of salinity, TSM and ISM. The presence of the mud blister worm (Polydora sp.) during rearing could be a real problem, as it damages oyster market value and threatens serious financial loss to the local farmers.

Blooms of the harmful alga Dinophysis acuminata, which produces okadaic acid (OA), are becoming recurrent in Santa Catarina coast, where most of the shellfish marine farms in Brazil are located. We evaluated the impact of D. acuminata blooms on various haemato-immunological parameters and on tissue integrity of cultivated oysters (Crassostrea gigas) and mussels (Perna perna). Animals were sampled during two natural algal blooms, one at Praia Alegre (PA: 2950 cells l−1) and the other at Praia de Zimbros (PZ: 4150 cells l−1). Control animals were sampled at the same sites, 30 days after the end of the bloom. The assayed parameters were: total (THC) and differential (DHC) haemocyte counts, percentage of apoptotic haemocytes (AH), phenoloxidase activity (PO), agglutinating titre (AT) and total protein concentration in haemolymph (PC). Histological analyses were carried out in oysters from PZ. The results showed that some immune parameters were modulated during the toxic blooms, but not in a consistent manner, especially in mussels that accumulated more OA (10×) than oysters. For example, mussel THC decreased significantly (54%) during the bloom at PA, whereas it augmented markedly (64%) at PZ. PO activity was significantly altered by the algal blooms in both bivalve species, while PC increased significantly (66%) only in mussels from PZ bloom. The other parameters (DHC, AH and AT) did not vary in both bivalve species. Histological analyses showed an intense haemocytic infiltration throughout the oyster digestive epithelium, particularly into the stomach lumen during the algal bloom.

The toxic dinoflagellate Alexandrium catenella recurrently blooms on thecoasts of France and produces Paralytic Shellfish Toxins (PSTs) that accumulate inbivalves. These toxins can affect various physiological functions including reproduction.The present study aims to validate measurements of sperm viability, DNA content andmitochondrial membrane potential in Pacific oyster Crassostrea gigasusing flow cytometry coupled with fluorescent markers, and to use thesemeasurements to assess the cellular parameters of sperm from Pacific oysters exposed toA. catenella. These parameters may influence fertilization,embryogenesis and larval development in free-spawning shellfish. Sperm viability and DNAcontent estimation were assessed using SYBR-14, which only penetrates cells with intactmembranes. Cell mortality was measured with propidium iodide (PI), which penetrates cellswith membrane damage. Mitochondrial membrane potential, used as an estimate ofmitochondrial function, was measured using JC-1 dye, which selectively enters intomitochondria and reversibly changes colour from green to orange as the membrane potentialincreases. To assess the effect of toxic algae on oyster sperm, broodstock (ripe oysters)were fed toxic (A. catenella) or non toxic (Heterocapsatriquetra) dinoflagellates at 250 cell ml-1 for 9 days. After thisexposure period, mature oysters were stripped and cellular responses of sperm analysed.Average DNA staining, as measured by SYBR-14, appeared lower and more variable in gametesfrom A. catenella-exposed oysters than in those from control oysters fedH. triquetra. Additionally, mitochondrial membrane potential of spermfrom A. catenella-exposed oysters was significantly higher (1.5 fold)than that of sperm produced by oysters fed H. triquetra. Both theincrease of mitochondrial membrane potential and the modification of DNA structure can beexpected to impact spermatozoa ability to fertilize oocytes and could thus impact relatedreproductive processes.

Sessile animals that live on the foreshore undergo tidal cycles, and have to facevariations in physical and chemical parameters such as oxygen concentration. Duringemersion, availability of dissolved oxygen can be lowered for bivalves, which have only asmall reserve of seawater inside their closed shell. Differences in oxygen concentrationare thus expected to lead to modifications of the metabolism, including changes inmitochondrial activity. Previous studies investigated air exposure under extremeconditions, which do not always reflect environmental conditions these invertebrates haveto cope with. In this study, oxidative capacities of gill mitochondria of the oysterCrassostrea gigas were studied during a tidal cycle period, bycomparing oysters collected after emersion and immersion. Only minor differences werefound in state 3 (oxidative phosphorylation) or state 4 (non-phosphorylating oxygenconsumption) rates between the two conditions. Similarly, no difference was observed incytochrome c oxidase activity or in oxygen consumption related to maximalelectron flux through complexes I-IV, II-IV and IV. While capacities of substrateoxidation were maintained in both emersion and immersion conditions, capacity ofmitochondria to produce adenosine triphosphate (ATP) was significantly lower in oysterssampled during emersion. These results suggest that although C. gigascould maintain aerobic metabolism during emersion period within a tidal cycle inits environment, energy producing mechanisms are affected.

Significant mortalities of the Pacific oyster, Crassostrea gigas, have been reported worldwide since the 1950s. The impact these re-occurring mortality events have had on the C. gigas industry has highlighted the necessity to determine the factors that may be causing these mortalities. This study investigated the possible role of ostreid herpes virus (OsHV-1) in C. gigas mortalities over 2 successive summers at 2 study areas in Ireland. A single sample of adult C. gigas, which had been experiencing mortalities at one of the sites was screened. Successive cohorts of C. gigas spat obtained from a hatchery outside Ireland was relayed to both sites in 2003 and in 2004. Spat were screened each year prior to relaying. Samples were collected every 2 weeks and mortality counts were recorded and observed at both sites. Polymerase chain reaction (PCR) analysis and subsequent sequencing indicated that a previously undocumented variant genotype of OsHV-1 was present in the single cohort of adult C. gigas and in seed and juveniles at both sites, in both years. Analysis suggests that the Irish OsHV-1 μvar variant genotype is closely related to OsHV-1 μvar, first described in France in 2008.

The State of Santa Catarina in southern Brazil is the most important Brazilian producer region. The Pacific oysters Crassostrea gigas and the brown mussels Perna perna are the main species currently produced. The occurrence and impact of parasites on bivalves from natural or culture populations from Brazil are still poorly studied. This work describes several diseases, parasites and commensals from four edible bivalve species, from cultured and exploited stocks, from five sites at Santa Catarina State. Unspecific histopathological symptoms of stress, parasites and commensals were found, including viral gametocytic hypertrophy and rickettsia-like organisms with very low prevalences; the protozoan Nematopsis sp. with high prevalence and, ovarian parasites with low prevalences; and, diverse metazoans, such as turbellarian, sporocysts and metacercariae of trematodes, metacestoda larvae and spionid polychaete. Ray's fluid thioglycollate medium assays for detection of Perkinsus spp. did not detect any infected bivalves. Polymerase chain reaction assays for Marteiliodies chungmuensis in oysters with ovarian lesions produced negative results.

French oyster farming has been subject to severe mortalities during the summer months.Results from the research program “Morest”, which ran from 2000 to 2006 and examined thepossible causes of these mortalities, led to the construction of a model to explain theinteraction between environmental factors, oyster physiology and different opportunisticpathogens underlying oyster summer mortality. Temperature, food, reproduction and stresswere the main factors required for oyster mortality. Genetically-based resistance (“R”oysters) or susceptibility (“S” oysters) to summer mortality was revealed by divergentselection. Building on these results, a literature search was made in 2007 on themolecular origin of genetic resistance to such a complex mortality risk. The objectiveswere to lay a foundation for the preparation and orientation of future research directionsand to improve understanding of the underlying physiological mechanism leading to summermortality. Three years later, the resulting conceptual analysis reported here waspresented as an introductory lecture to Physiomar 2010, a conference where many newresults contributing to this research field were also reported. The literature reviewhighlighted two major review articles: the first dealing with nutrition and reproduction(Schneider 2004), the second with reproduction,temperature, oxidative stress and mortality (Heineinger 2002). The effect of nutrition level on energy orientation to growth orreproduction is controlled by endocrine factors. Among these, neuropeptide Y (NPY),ghrelin and leptin neuropeptides appeared to be potential candidates involved in germ-somaorientation in relation to trophic conditions. Depending on reproductive effort andtemperature, a metabolic stress resulting from the germ-soma conflict can appear,characterized by mitochondrial reactive oxygen species (ROS) production. Such an excess ofROS induces perturbations in mitochondrial activity leading to cell death. Many organisms,such as annual plants or the Pacific salmon, do not survive their first reproduction. Incontrast, others increase stress resistance by selection of antioxidant processes(superoxide dismutase SOD, catalase, etc.) through evolution, and survive firstreproduction. A similar difference was observed in the comparison made between R and Soysters, which differed in ROS production, SOD and catalase levels. Such factorscontrolling reproduction and ROS detoxification processes could therefore provide newmarkers for selection of oysters with better resistance to non-specific pathogens,complementing other classic selection approaches against specific pathogens or forimproved immunity. This antioxidant defence mechanism is found in many organisms includingvertebrates and in some invertebrates, including oysters. Its role needs to be consideredin pathology events involving other aquaculture species and it may also contribute toexplaining the increase in marine pathologies under anthropogenic environmental changes.

A technique was developed for dissection and isolation of male germ cells in the oyster Crassostrea gigas. This procedure can provide cells for the exploration of processes involved in the reproductive physiology of bivalves. Spermatogonia were chosen because of their essential role in spermatogenesis and the impact of gonia proliferation on reproductive effort. A non lethal method for determining sex and reproductive cycle stage was first validated in oysters. This first step was essential in order to constitute a homogeneous pool of oysters at the same stages of gametogenesis. Germ cell fractions were then obtained from a density gradient, and enrichment of each fraction was ratified by electron microscopy and by means of a 2-parameter flow cytometry procedure (DNA and mitochondrial staining). A significant enrichment in spermatogonia and spermatocytes was confirmed by the increased expression of markers of proliferative cells (proliferative cell nuclear antigen, PCNA) and early germ cells (oyster vasa-like gene). A preliminary cell sorting procedure is also reported, which was applied to fractions enriched in spermatogonia.

This study investigated the ability of the Pacific oyster, Crassostrea gigas, to act as a carrier or reservoir of the protistan Bonamia ostreae. Studies were carried out independently in Ireland and in Spain. Naïve C. gigas were exposed to B. ostreae both in the field and in the laboratory via natural exposure or experimental injection. Naïve flat oysters, Ostrea edulis, were placed in tanks with previously exposed C. gigas. Oysters were screened for B. ostreae by examination of ventricular heart smears and by polymerase chain reaction (PCR) screening of tissue samples (gill and/or heart) and shell cavity fluid. PCR-positive oysters were further screened using histology and in situ hybridization (ISH). B. ostreae DNA was detected in the tissues and/or shell cavity fluid of a small number of C. gigas in the field and in the laboratory. B. ostreae-like cells were visualized in the haemocytes of 1 C. gigas and B. ostreae-like cells were observed extracellularly in the connective tissues of 1 other C. gigas. When C. gigas naturally exposed to B. ostreae were held with naïve O. edulis, B. ostreae DNA was detected in O. edulis; however, B. ostreae cells were not visualized. In Spain, B. exitiosa DNA was also detected in Pacific oyster tissues. The results of this study have important implications for C. gigas transfers from B. ostreae-endemic areas to uninfected areas and highlight B. ostreae and B. exitiosa's ability to survive extracellularly and in other non-typical hosts.

Mikrocytos mackini is the etiological agent of Denman Island disease, which causes significant mortalities in commercially important bivalve species, including the Pacific oyster, Crassostrea gigas. A close relative of M. mackini, Mikrocytos sp., was recently detected in oysters imported into France from Canada. In this study, we examined Pacific oysters from the northern coast of the Yellow Sea, China. Of the one hundred samples examined histologically, a microcell parasite was found in the tissues of four oysters. To identify whether the parasite was Mikrocytos sp., DNA was extracted from the oysters and polymerase chain reaction (PCR) amplifications were performed with primers (Mikrocytos-F and Mikrocytos-R), which yielded the expected 522 bp fragment. DNA sequencing of these products confirmed that they were identical to the corresponding 18S region of Mikrocytos sp. (100%) and had close similarity to M. mackini (89%). In situ hybridization (ISH) also was performed in this study, and the primer pair MM-like (CCTGTCCTATGTCGGGCAGG) hybridized with the Pacific oyster parasite. This is the first report of Mikrocytos sp. in the Pacific oyster from the coast of China. Although this study suggests a low prevalence of the parasite in China, its potential threat to aquaculture should be considered.

To make a preliminary exploration of the possibilities and limits of magnetic resonance imaging (MRI) for assessing body growth and gonad development of the Pacific oyster, Crassostrea gigas, individual monitoring was conducted on diploid and triploid oysters in their second year, maintained from February to October in a pond on the French Atlantic coast. Magnetic resonance imaging was done on each oyster on five dates during the study period. From these images, variations in the volumes of the flesh, digestive gland–gonad and adductor muscle, and the surface of the gills were measured over time. Apart from the well known differences between diploids and triploids related to maturation of gametes, other original observations of assessing growth were made from these MRI measurements using a non-invasive technique. The standard error of mean dry flesh variation was lower than that found by other commonly used measurement methods. A negative correlation was established between the volume of the gametes spawned and the increase in dry flesh volume after spawning. Moreover, these variations were correlated with the chemical composition of the adductor muscle. All these observations and conclusions need to be confirmed by further observations on oysters of different sizes or grown in different environments.

The proliferation of the voluntarily-introduced cupped oyster, Crassostrea gigas, has attained the proportions of species invasion in many intertidal habitats in Europe, presumably resulting from successful reproduction of farmed individuals. It is thus imperative to better understand the reproductive characteristics of farmed oysters, since they are directly under human control. We quantified the dry tissue mass (DTM), gametosomatic index (GSI), and reproductive cycle of farmed oysters at two sites in Bourgneuf Bay, France, in relation to environmental parameters using continuously-recording probes in 2005 and 2006. The GSI was developed for this study, based on the actual area occupied by gametes, rather than the area of the gonad previously used for quantitative histological estimation of reproductive effort. The two sites, intermediate – (IT) and high-turbidity (HT), differed markedly in the amount and quality of particulate suspended matter, and also in fine-scale temperature variations. Oysters at both sites presented two spawning periods in both 2005 and 2006; Bourgneuf Bay is thus near the northernmost European limit for a 2-spawning cycle in Crassostrea gigas. Gonad maturation was initiated when spring water temperature reached 8–10 °C, and gamete atresia occurred when water temperatures transiently dipped to 15–18 °C. Spawns, which occurred above 18 °C, were timed by fine-scale water temperature variations. Particulate organic matter quality peaks, coinciding with gonad maturation, were related to DTM variations before spawning periods, for the IT oysters in both years, and for the HT oysters in 2006. The reproductive effort (GSI) of oysters was similar at both sites; however, the fates of the gametes differed according to site. At the first spawning, the IT oyster gamete emissions were +1 month delayed, as were peak water temperatures greater than 18 °C, and more pronounced, compared to the HT site. Although the second spawning showed high proportions of atretic oocytes at both sites in both years, the IT oysters evacuated twice as many gametes as the HT oysters in 2005. The IT conditions therefore appear more suited to Crassostrea gigas gamete evacuation than the HT conditions.

A single trophic interaction between two major biotic components within similar ecosystems can reveal high variability. In fact, in situ measurements of the trophic interactions, as provided by the field application of stable isotopes, are likely to reveal strong differences in patterns. An illustration of such a geographical plasticity is provided when regarding the trophic interaction between two major components of intertidal habitats namely, the oyster Crassostrea gigas and the microphytobenthos. The contribution of benthic diatoms to oysters' diets ranged from 4.4±3.5% in the Mont St Michel bay to 69.6±1.1% in the Marennes-Oléron bay, as estimated from δ13C and δ15N analyses. Concerning food web investigations, these results point out serious limits for extrapolating qualitative and quantitative observations related to the major trophic links between identical food sources and consumers inhabiting similar ecosystems.

A reliable anaesthesia and sampling protocol for Pacific oysters will enable experiments to be conducted without sacrificing animals and will facilitate successive sampling of individuals for gametogenesis studies. As no such techniques were available for Crassostrea gigas, the present study aimed to define suitable anaesthetic conditions for use with this species. Three groups of ten oysters (mean weight ± SD, 32.1 ± 9.0 g) were anaesthetised in 5 L containers. Among different chemicals: benzocaine, eugenol and three different types of magnesium chloride (a laboratory one – Flucka® – and two designed for agriculture – DEUSA International® and Dead Sea Works®) and concentrations tested, one laboratory (concentration: 72 g L−1) and one agricultural (Dead Sea Works® 50 g L−1) type of magnesium chloride were the most effective, respectively inducing anaesthesia in 73 ± 3% and 80 ± 3$% after three hours. Lower oyster weight and a two day period of starving prior to treatment significantly increased the number of anaesthetised animals. Using this protocol, losses of 0 to 10% of oysters were observed one week after anaesthesia. Increasing anaesthesia duration from 3 to 16 h resulted in a significant increase in the number of anaesthetised oysters (from 50 ± 10 to 97 ± 7%) but no increase in mortality (7 ± 11%). On the other hand, reducing water temperature from 19.5 °C to 15.3 °C, resulted in a significant decrease in anaesthesia efficacy. A reliable anaesthesia protocol was developed: 100% of Pacific oysters are anaesthetised using 50 g L−1MgCl2 Dead Sea Work®for a 16 h duration. This long duration facilitates tissue sampling and does not increase the working time needed. This protocol was validated by monthly anaesthesia and gonad sampling during a three month period with the loss of only a single oyster. It can thus be used for routine applications.

Parameters of hemocyte populations have been considered as relevant indicators of bivalve health and are currently used in immunotoxicological studies. Hemocytes in hemolymph can be collected by puncturing either the pericardial cavity or the adductor muscle sinus with a syringe. Flow cytometry is a methodological approach that is increasingly being used in laboratories for the study of hemocyte parameters in aquatic invertebrates. However, various protocols for hemocyte processing in laboratories equipped with different types of cytometers have been published. In this context, two flow cytometers (EPICS XL4®, Beckman Coulter and FacsCalibur®, Becton Dickinson) and two sites of hemocyte collection (pericardial cavity and adductor muscle sinus) were compared for the analysis of hemocyte parameters in the Pacific oyster, Crassostrea gigas. Hemolymph cells were analyzed in terms of their number and organelle contents. Cell mortality, phagocytosis, non specific esterase, extension of the lysosomal compartment and production of reactive oxygen species were quantified. The results showed that the phagocytic index was higher for hemocytes obtained in the muscle sinus hemolymph. The results are discussed with respect to the potential use of flow cytometry as a tool for hemocyte studies in bivalves.

Contamination of shellfish by paralytic shellfish poisoning (PSP) toxins poses an economic threat to shellfish farmers. As contaminated shellfish cannot be harvested for long periods of time, it would be very useful to develop processes to optimise and shorten their detoxification. In this study, Pacific oysters Crassostrea gigas were first experimentally contaminated over a period of 13 days with a continuous flow of toxic Alexandrium minutum cultures at concentrations ranging from 150 to 200 cell ml-1 (toxin content after 13 days of contamination 438 $\mu $ g STX equiv. 100 g−1 wet weight). Then, two different detoxification treatments were tested and showed detoxification rates greater than those observed in coastal environments. The first treatment consisted of feeding oysters on Skeletonema costatum, at a concentration of 2000 cell ml−1 to speed up detoxification rates. The second detoxification method used the same Skeletonema costatum diet, supplemented with silt particles at a concentration of 20 mg L−1. A control was also set up by placing contaminated oysters in seawater with no additional algal food. The detoxification experiment lasted 8 days. Toxin contents were analysed by liquid chromatography with fluorescence detection (LC-FD). The S. costatum diet significantly reduced the time needed for oysters to reach the sanitary threshold (80 $\mu $ g STX equiv. 100 g−1 wet weight), but no effect of the silt supplement could be demonstrated conclusively. These different detoxification methods did not influence toxin biotransformations as observed in oyster tissues, i.e. epimerisation and decarbamoylation of gonyautoxins 2 and 3.

The occurrence of new phytoplankton species in a coastal area may be explained by the import of shellfish containing whole live algal cells in their digestive tracts. Indeed, shellfish containing toxic algal cells can induce both primary contaminations in safe areas (initially free from toxic microalgae), and secondary contaminations of other shellfish growing in the same area via the faeces of the imported animals. To mitigate this problem, shellfish need to be placed in a separate holding tank and their intestinal content purged. For a deeper understanding of the risks associated with transferring contaminated shellfish, oysters (Crassostrea gigas) and mussels (Mytilus edulis) were purposely fed either Alexandrium minutum or A. catenella (Dinophyceae) or Pseudo-nitzschia calliantha (Bacillariophyceae) toxic algae for 2 h. They were then transferred into individual tanks where they were continuously fed with a non-toxic alga, Tetraselmis suecica. Biodeposit production, faeces composition, and filtration rates were monitored for the shellfish over a 6-h period. The effect of temperature differences and different initial toxic algae concentrations were compared. This study revealed a relationship between temperature and cell lysis in the oyster digestive tract. It also indicated that toxic algae concentration did not seem to influence gut passage time in oysters, while a significant effect was observed in mussels, and confirmed the existence of a difference between oyster and mussel feeding patterns.

The taxonomic status of the cupped oysters Crassostrea angulata and C. gigas has received considerable attention in the last decades. Based on larval shell morphology, experimental hybridization, allozymes and nuclear DNA studies several authors have considered these two taxa as being synonymous. However, mitochondrial data showed clear genetic differences between the two taxa. In addition, microsatellite-based studies and cytogenetic studies have also provided evidence that supports their differentiation. Considerable differences have also been observed at the phenotypic level in terms of growth rate and ecophysiological parameters. In the present study, C. angulata from Sado estuary (Portugal) and C. gigas from Seudre estuary (France) were collected and factorial crosses were performed. Juveniles of the different progenies were reared in Ria Formosa (Portugal) under common conditions to determine if they exhibited differences in shell shape and in pigmentation of the adductor muscle scar. Significant morphometric differences between C. angulata and C. gigas progenies were indicated by univariate and multivariate analyses. Univariate analysis of size-adjusted shell measurements revealed significant differences between the two taxa for shell depth, muscle scar height, and length of ligamental area. Both reciprocal hybrids showed intermediate morphometric characters between parental lines. In addition, significant differences were also observed between C. angulata and C. gigas progenies in terms of pigmentation of adductor muscle scar. C. angulata and both reciprocal hybrid progenies showed highly pigmented adductor muscle scars whereas in C. gigas progeny the pigmentation was lighter. The differences in shell shape and muscle scar pigmentation observed in the present study support the distinction of the two taxa.

In October and November 2003 a bloom of the toxic dinoflagellate Alexandrium catenella was observed in the North-east zone of Thau lagoon (French Mediterranean coast). Sea water samples were collected every hours to evaluate time-related variations of phytoplankton concentrations and to compare the relative ratio of A. catenella versus other phytoplankton species during the outbreak. From these observations, trials using recirculated sea water systems were performed to: i) evaluate the physiological effects on oyster of increasing proportions of A. catenella within a mixed microalgal diet where the non-toxic diatom Thalassiosira weissflogii was present at concentration: 1500 cells ml−1, ii) compare the effect of two temperatures (12 °C and 18 °C) on paralytic toxin accumulation rates in oyster flesh by ion-pairing high performance liquid chromatography (IP-HPLC) detection, iii) analyse toxin biotransformation during the contamination process, iv) evaluate the role of the different types of oyster tissue on the bioaccumulation mechanism.

The results showed: i) a significant effect of temperature increase on clearance rate and toxin uptake, ii) no detectable time-related effects of toxic algal food on pre-ingestion sorting or on toxin profiles in oyster flesh, iii) either negative or positive effects of A. catenella concentrations on toxin uptake (“threshold” effect), iv) high amounts of toxins in the digestive gland, accounting for more than 80% of overall shellfish toxicity. The daily amount of toxins (Q tox) taken up by each oyster was evaluated by means of a global one-compartment model. However a two-compartment model finally gave the best match with real contamination kinetics, since it integrated both toxins sequestered in oyster tissues and toxins moving in through the digestive tract.