Over the past decades, pollution, overfishing, and habitat degradation have driven the population size of Taiwan shoveljaw carp down markedly in Taiwan. Cryopreservation is a useful tool which could be used to maintain genetic resources to protect and preserve this endemic species. Four cryoprotectants [dimethyl sulphoxide (DMSO), dimethylacetamide (DMA), glycerol and methanol] and six freezing rates (0.5, 1, 2, 4, 8, 16 °C min-1) were tested in order to develop an optimal controlled slow-freezing protocol for Taiwan shoveljaw carp spermatozoa. Samples were subsequently examined under the scanning electron microscope to reveal whether cryopreservation had affected their ultrastructural morphology. The highest survival rate (50.1 ± 2.0%) was observed with a freezing rate of 8 °C min-1 in 1M DMSO, using SYBR-14 + PI staining. Fertility and hatching rate results using frozen-thawed spermatozoa (90.2 ± 2.2% and 22.3 ± 2.5%, respectively) were not significantly different from results with fresh spermatozoa. After cryopreservation, 21.0 ± 1.6% of frozen-thawed spermatozoa had mid-piece swelling and rupture of the head. Cryopreservation might, therefore, slightly affect Taiwan shoveljaw carp spermatozoa in terms of morphological change. However, these alterations could be compensated by using large enough numbers of normally functioning frozen-thawed spermatozoa to achieve a standard equal to fresh spermatozoa. This is the first report of successful cryopreservation of Taiwan shoveljaw carp spermatozoa using a controlled slow-cooling method.

Mikrocytos mackini is the etiological agent of Denman Island disease, which causes significant mortalities in commercially important bivalve species, including the Pacific oyster, Crassostrea gigas. A close relative of M. mackini, Mikrocytos sp., was recently detected in oysters imported into France from Canada. In this study, we examined Pacific oysters from the northern coast of the Yellow Sea, China. Of the one hundred samples examined histologically, a microcell parasite was found in the tissues of four oysters. To identify whether the parasite was Mikrocytos sp., DNA was extracted from the oysters and polymerase chain reaction (PCR) amplifications were performed with primers (Mikrocytos-F and Mikrocytos-R), which yielded the expected 522 bp fragment. DNA sequencing of these products confirmed that they were identical to the corresponding 18S region of Mikrocytos sp. (100%) and had close similarity to M. mackini (89%). In situ hybridization (ISH) also was performed in this study, and the primer pair MM-like (CCTGTCCTATGTCGGGCAGG) hybridized with the Pacific oyster parasite. This is the first report of Mikrocytos sp. in the Pacific oyster from the coast of China. Although this study suggests a low prevalence of the parasite in China, its potential threat to aquaculture should be considered.

Pearl oyster grafting is a complex surgical operation that should lead to pearl formation after approximately eighteen months. Although this technique has been used for many years in French Polynesia, the grafting process is still not standardised. While studies have been carried out in order to improve graft performance and yield, these remain highly variable due to post-grafting mortality, nucleus rejection and unreliable pearl quality, all of which constrain pearl farm profitability. The present study uses histological analysis to monitor oysters that either rejected or retained their nuclei. Both groups of oysters are compared in terms of evolution of the graft, which could influence retention, and the development of a pearl sac in cases where grafting was successful. Data show that rejection phenomena are linked to a number of causes, notably an inflammatory reaction in the “receiving” oyster, the presence of numerous tissue lesions and the quality of the grafted tissue. These results suggest that study is needed on the different concomitant elements of the grafting process: the graft “donor” oysters, the nucleus and the “receiving” oyster and their interactions.