Hostname: page-component-f554764f5-rvxtl Total loading time: 0 Render date: 2025-04-13T19:17:11.894Z Has data issue: false hasContentIssue false

Dissecting the relationships between the insect vector Empoasca paraparvipenis with Camptotheca acuminata witches’ broom phytoplasma

Published online by Cambridge University Press:  21 November 2024

Hong Cai
Affiliation:
Key Laboratory of Agro-Biodiversity and Pest Management of Education Ministry of China, Yunnan Agricultural University, Kunming 650201, China
Menglan He
Affiliation:
Key Laboratory of Agro-Biodiversity and Pest Management of Education Ministry of China, Yunnan Agricultural University, Kunming 650201, China
Yinfeng Cai
Affiliation:
Key Laboratory of Agro-Biodiversity and Pest Management of Education Ministry of China, Yunnan Agricultural University, Kunming 650201, China
Kai Qiao
Affiliation:
Key Laboratory of Agro-Biodiversity and Pest Management of Education Ministry of China, Yunnan Agricultural University, Kunming 650201, China
Weiyi Huang
Affiliation:
Key Laboratory of Agro-Biodiversity and Pest Management of Education Ministry of China, Yunnan Agricultural University, Kunming 650201, China
Shahzad Munir*
Affiliation:
State Key Laboratory for Conservation and Utilization of Bio-resources in Yunnan, Yunnan Agricultural University, Kunming 650201, China
*
Corresponding author: Shahzad Munir; Email: [email protected]
Rights & Permissions [Opens in a new window]

Abstract

Phytoplasmas are phloem-limited bacteria that are primarily transmitted by hemipteran insects and are emerging threats to Camptotheca acuminata Decne plants due to their associations with a witches’ broom disease. Despite numerous studies, there has been no report on insect transmission of phytoplasma among C. acuminata. Here, transmission characteristics of the leafhopper, Empoasca paraparvipenis Zhang and Liu, 2008 and the phytoplasma in plant leaves through PCR quantification are described. The interaction between C. acuminata-phytoplasma and insect vectors was examined by analysing the impact on the life characteristics and progeny population in a temperature-dependent manner. Phytoplasma-infected C. acuminata plant exhibited symptoms including shorter internodes, weak and clustered branches, shrunken and yellowed leaves, and red leaf margins. The acquisition and transmission time of bacterial-infected third-instar nymphs of insect vectors were 10 (11.11%) and 30 min (33.33%), respectively. A single insect vector can infect a plant after 72 h of feeding, and the incidence rate of disease increases with the number of insects following 11–100% from single to 20 insects. The development time of the infected insect vectors (1–3 instars) was significantly shorter than that of the healthy insects, and the development duration of instar individuals was longer. In progeny populations, the higher the phytoplasma concentration (88–0% for 1–5 instars nymph, female and male adults), the shorter the development time and the longer the adult lifetime (both male and female). These findings provided research evidence of phytoplasma transmission by insect vectors; however, further investigation of the mechanisms for prevention and management of phytoplasma diseases is needed.

Type
Research Paper
Copyright
Copyright © The Author(s), 2024. Published by Cambridge University Press

Introduction

Phytoplasmas, previously known as mycoplasma-like organisms, are a large group of plant-pathogenic, without cell wall, non-helical bacteria associated with diseases that affect vegetables, cash crops, fruit trees, weeds and ornamental plants, generally associated with stunting, proliferation, virescence and yellowing (Dermastia, Reference Dermastia2019). Phytoplasmas are localised in host plant phloem sieve tube cells (Marcone, Reference Marcone2009, Reference Marcone2014). Most of them colonise hemipteran insects such as Cicadellidae, Delphacidae and Psyllidae which feed on phloem sap (Hemmati et al., Reference Hemmati, Nikooei, Al-Subhi and Al-Sadi2021; Wang et al., Reference Wang, Chien, Liao, Chiu, Chen and Yang2021a). According to research on the diseases spread by the insect vector Empoasca paraparvipenis Zhang and Liu, 2008, the leafhopper not only spreads tomato giant bud disease and tobacco yellow dwarf disease but also other diseases such as alfalfa witches’ broom and potato purple top disease (Bertaccini et al., Reference Bertaccini, Fiore, Zamorano, Tiwari and Rao2019; Trivellone et al., Reference Trivellone, Cao and Dietrich2022).

Insect transmission is a complex process in a phytoplasma–insect–plant relationship. The process of phytoplasma transmission by insect vectors typically includes three main stages: feeding, incubation, and inoculation (Mou et al., Reference Mou, Di Lella, Halbert, Bextine, Helmick and Bahder2022). During feeding, the insect vector ingests phytoplasma via the phloem sap of the diseased plant, that phytoplasma is absorbed into the midgut and invades the insect's intestinal cells, adjacent muscle cells, and haemolymph. This period to acquire the phytoplasma is referred to as the acquisition access period (Bosco and Tedeschi, Reference Bosco, Tedeschi, Dickinson and Hodgetts2013; Ranebennur et al., Reference Ranebennur, Rawat, Rao, Kumari, Chalam, Meshram and Rao2022). Depending on the insect species, feeding period can range from a few minutes to days to ensure that enough phytoplasma is obtained (Palermo et al., Reference Palermo, Arzone and Bosco2001; Marzachì et al., Reference Marzachì, Milne and Bosco2004).

Furthermore, many insect carriers that feed on phloem can acquire phytoplasma but cannot transmit it. As a result, identifying the transmission ability of insects, rather than only their ability to acquire and carry phytoplasma is critical in determining phytoplasma insect vectors (Kumari et al., Reference Kumari, Nagendran, Rai, Singh, Rao and Bertaccini2019). Previously, it was found that phytoplasma vector Asymmetrasca decedens was the most efficient vector responsible for carrying ‘Candidatus Phytoplasma phoenicium’ (Abou-Jawdah et al., Reference Abou-Jawdah, Abdel Sater, Jawhari, Sobh, Abdul-Nour, Bianco, Molino Lova and Alma2014). In addition, nine potential alternative insect vectors were found to transmit ‘C. Phytoplasma solani’ to grapevines in Italy (Quaglino et al., Reference Quaglino, Sanna, Moussa, Faccincani, Passera, Casati, Bianco and Mori2019). Based on this, we assume that there is not one vector species involved in carrying the pathogen from the infected to the healthy host, but different vectors could be involved in carrying the pathogen. Therefore, the detection of phytoplasma in the insect body alone cannot prove that the insect is a vector; only the transmission test provides conclusive evidence (Killiny and Almeida, Reference Killiny and Almeida2014).

Camptotheca acuminata is a tall plant that grows in China and is used as an ornamental, source of timber, and in the medicine (Zhang et al., Reference Zhang, Shunli and Feiping2002; Xing, Reference Xing2004). The number of wild C. acuminata plants is seriously affected by environmental changes, diseases, and insect pests. Camptotheca acuminata witches’ broom associated with the presence of phytoplasma is a systemic disease resulting in stunted growth, shortened internodes, and smaller leaves in plants (Wei et al., Reference Wei, Jiang and Depo2006; Xu et al., Reference Xu, Gang and Wanbin2009; Wang, Reference Wang2018). This severely impedes the development of the C. acuminata plant industry and the pharmaceutical industry. The biology, ecology and management strategies of C. acuminata leafhoppers were studied in our previous work (Wang et al., Reference Wang, Wang, Yuan, Su, Mao, Wan and Cai2021c). Still, the transmission characteristics of phytoplasma diseases and insect vectors have not been examined yet. Therefore, the current study focuses on the transmission characteristics of leafhopper insects in the C. acuminata community to investigate the interaction between C. acuminata- phytoplasma and insect vectors (E. paraparvipenis).

Materials and methods

Insects, plants, and pathogen

The adults and nymphs of the leafhopper (E. paraparvipenis) were collected using a net from infected leaves in the C. acuminata community in Wenshan (23°21′47.02″ N 104°15′1.69″ E), Yunnan Province, China and placed in an insect feeding cage. The leafhopper-rearing C. acuminata plants were obtained from Huatao Gardening Farm, followed by their transplant into pot. Healthy C. acuminata plants were screened for phytoplasma infection with polymerase chain reaction (PCR) and placed in an insect cage to be cultured in the greenhouse for the pathogen transmission test. The phytoplasma was detected through a TaqMan probe-based quantitative PCR (qPCR) method that specifically identifies the member of phytoplasma group 16SrXXXII as performed in our previous study (Wang et al., Reference Wang, Yuan, Su, Wan and Cai2021b).

DNA extraction and PCR amplification

OMEGA plant DNA extraction kit (D5511-02) was used to extract DNA from the leaves of C. acuminata as per manufacturer instructions (Omega Bio-tek, Inc., Norcross, GA, USA). Total DNA was extracted from leafhoppers using an insect DNA extraction kit according to manufacturer instructions. The 16S rRNA gene of phytoplasma was amplified by PCR using the DNA of the infected C. acuminata plants and the leafhoppers, concerning the universal primer of phytoplasma designed by Lee (Lee, Reference Lee1993; Schneider et al., Reference Schneider, Ahrens, Kirkpatrick and SeemuLler1993). PCR amplification was carried out with Phanta Max Super-Fidelity DNA polymerase and 2 Phanta buffer (Nanjing, China). Electrophoresis was carried on 1% agarose gel to detect PCR products. The PCR product was purified with the Cycle-Pure Kit for PCR Product Purification (Omega Bio-tek, Inc.).

Quantitative determination of phytoplasma in leafhoppers and plants by a fluorescent dye method

A real-time fluorescent dye method was used to screen the universal primers 16SrXXXIIF (ACGCTGTTCTGTTATAGA) and 16SrXXXIIR (GTTCCTCCATATATTTACACA), which were synthesised by Beijing Qingke Biotechnology Co., Ltd. qPCR SYBR Green Master Mix (Nanjing Novozan Biotechnology Co., Ltd.) and Bio-Rad (CFX96, USA). qPCR was used with 16S rRNA gene recombinant plasmid of C. acuminata phytoplasma as the internal reference gene; in addition to the host plant, the pathogen-acquired leafhopper DNA was used as the template. A qPCR reaction was carried out with three technical replications according to the SYBR green reagent and qPCR instrument instructions, with a melting curve of 60–95°C.

Identification of insect transmission ability

At 28°C, 20 highly infected insect nymphs (collected from diseased hosts) were transferred in each group to healthy C. acuminata plants for 5, 10, 30 min, 1, 3, 6, 24, and 48 h. Each treatment (n = 3) was repeated three times with three plants in each replicate, and cages of plants were covered with a net. After 10 days of feeding with infected insects, the plants were collected, and DNA was extracted separately to detect the bacterial load in the plants.

Determination of the transmission effect of different numbers of insects

At 28°C, the numbers of infected nymphs 1, 3, 5, 10, 15, and 20 were allowed to feed on healthy C. acuminata plants. Each treatment (n = 3) was carried out three times with three plants in each replicate, and the insects were removed after 72 h. The DNA of insects and plants was then extracted, and the rate of diseased insects and plants was detected by amplification through PCR.

Determination of the transmission effect of different development stages of insects

At 28°C, the infected insects (collected from diseased host) were allowed to feed on the healthy C. acuminata plants according to their age: instar (1, 2, 3, 4, 5, adult male, adult female). Each treatment treated three seedlings of the C. acuminata plant, with three replications. Treatments were placed in the insect cage, and the insects were removed after 3 days. Then the total DNA of insects and plants was extracted, the susceptibility was detected by PCR amplification, and the disease occurrence rate was calculated.

Effects of Camptotheca acuminata phytoplasma strains on the life parameters of its insect vector

Healthy and infected first-instar insects were separately caged in groups of 30 on non-infected plants and maintained at temperatures of 16, 20, 25, 28, 30, and 31.5°C. Insect development duration of all stages was observed until death. After the emergence of insects, the female and male leafhoppers were identified with the naked eye, and the life spans were compared under the conditions of being infected and healthy. After the death of the leafhopper, qPCR was performed to confirm the infected insect vector.

Effects of Camptotheca acuminata phytoplasma strains on the progeny populations of its insect vectors

At 28°C, fifth instars were reared to adult in groups of 80 on healthy and infected plants. Female and male adults were collected after 2 weeks and paired for mating as groups of equal 30 males and 30 females held separately in the same cage. After 3 days, each treatment group was split into two subgroups each consisting of 15 males and 15 females caged on healthy C. acuuminata seedlings (n = 3 × 3). The offspring of these adults were reared to adults. During the period, the progeny populations were recorded by observing their life span (male 9 days; female 17 days).

Statistical analysis

The phytoplasma content in fluorescence qPCR was calculated using the 2−△△CT method (Schmittgen and Livak, Reference Schmittgen and Livak2008). The data were statistically analysed using analyses of variance in IBM SPSS Statistics 20.0 software; the means were subjected to Duncan's multiple range test at P ≤ 0.05 and multiple comparisons in the Data Processing System (DPS) software (Hangzhou Ruifeng Information Technology Co., LTD, Zhejiang, China) were used to analyse the amount of phytoplasma expression and life spans. The amplification diagram and fusion curve of phytoplasma were both from real-time fluorescence qPCR.

Results

Symptoms of indoor and outdoor phytoplasma-infected Camptotheca acuminata plant

To gain insight into the detailed symptoms, continuous observation of C. acuminata in the field and greenhouse (Wenshan, Yunnan Province, China) revealed that phytoplasma-infected plants had apparent symptoms all year till plant death (fig. 1). The symptoms were short internodes, branches weak and clustered, leaves shrunk and yellowed and leaf margins somewhat red (fig. 1A, B1) in the infected plant (fig. 1B2) as compared to the field-healthy C. acuminata (fig. 1B1). The infected plants (fig. 1C) symptoms were identical to those of the field plants, with exceptions for the clumps in comparison with the healthy indoor C. acuminata plants (fig. 1D2). After phytoplasma invaded the leaves, lesions on the leaves extended from the leaf tip or edge to the leaf vein.

Figure 1. In vitro and in vivo symptoms of C. acuminata (AB in vivo symptoms; CD in vitro symptoms; B1 and D1 infected C. acuminata; B2 and D2 healthy C. acuminata).

Pathogen-transmission by Empoasca paraparvipenis

Bacterial-infected third-instar nymphs of insect vectors were fed on healthy C. acuminata plants during different time intervals for 5, 10, 30 min, 1, 3, 6, 24, and 48 h. After 10 days, the occurrence rate of C. acuminata at different inoculation times was 0.00, 11.11, 33.33, 33.33, 33.33, 44.44, 77.77, and 66.66%, respectively (table 1). Except for 5, 10, and 30 min after inoculation, phytoplasma detection revealed amplification bands in the leaves of C. acuminata (fig. S1A). The melting curve for C. acuminata leaves was a single peak, and the three replicates at 5 and 10 min in the amplification curve were negative amplification. In contrast, the other six treatments were positive amplification from 30 min to onwards (figs S1BC and S2AB).

Table 1. Pathogen transmission ability of Empoasca paraparvipenis during different time intervals

Note: Each treatment was repeated three times and the means were subjected to Duncan's multiple range test at P ≤ 0.05. Different letters showed significant differences.

The incidence rate of C. acuminata was noted as 33.33% 10 days later for 30 min, and the Ct value of phytoplasma amplification in leaves was 30.05, indicating positive amplification. The rate of C. acuminata after 24 h was 77.77%, and the Ct value of phytoplasma amplification in leaves was 23.55. The leaves phytoplasma concentration and incidence rate increased as pathogen transmission time increased (fig. 2). The third-instar nymphs had the shortest transmission time of 30 min. The higher the phytoplasma content in the body, the shorter the time to show symptoms and the higher the incidence rate.

Figure 2. Pathogen-transmission ability of insect vector. Relative expression of phytoplasma in C. acuminata leaves in different pathogen transmission time and ability of E. paraparvipenis. Each treatment was repeated three times, and the means were subjected to Duncan's multiple range test at P ≤ 0.05. Different letters showed significant differences over time.

Transmission effects of different insect vector numbers

The highly infected insect vector third-instar nymphs of leafhoppers were allowed to feed for 72 h on healthy C. acuminata plants in groups of 1, 3, 5, 10, 15, and 20. After 10 days, the pathogen detection concentration of plants was 11.11, 11.11, 44.44, 33.33, 77.77, and 100%, respectively. Plants and leafhoppers were tested for phytoplasma, which revealed that the leafhoppers DNA was all amplified in vivo with a single band size (fig. 3A), whereas phytoplasma amplification bands with a fragment size of about 1200 bp were found in plant leaves (fig. 3B). The phytoplasma content in leafhoppers and plants was detected using qPCR, and the results showed that the melting curves and internal reference genes were single peaks, indicating that the amplification products were single with good specificity, and the samples were positive (15 < Ct < 35) (fig. S3AB).

Figure 3. Gel electrophoresis of phytoplasma: (A) in different numbers of E. paraparvipenis (M: marker; 1: positive control; 2: 1 insect; 3: 3 insect; 4: 5 insect; 5: 10 insect; 6: 15 insect; 7: 20 insect; 8: negative control.); (B) in C. acuminata leaves at different amount inoculation (M: marker; 1, 12: positive control; 2–4: 1 insect; 5–7: 3 insect; 8–10: 5 insect; 11–13: 10 insect; 16–18: 15 insect; 19–21: 20 insect; 11, 22: negative control).

One leafhopper fed on healthy C. acuminata for 72 h, and 10 days later, the plant incidence rate was 11.11%, with a Ct value of 29.45 for phytoplasma amplification in the leaves. After 72 h of feeding on healthy C. acuminata, the plant incidence rate reached 100%, with a Ct value of 22.41 for phytoplasma amplification in leaves (table S2). The incidence rate of C. acuminata increased with insect population density, showing that the denser the population, the higher the transmission efficiency (fig. 4AB). Regression analysis indicated that a positive relationship was found between a number of vectors per plant and relative expression in the plant or the proportion of plants that become infected, as shown in the figure.

Figure 4. Regression analysis indicating transmission effects of different insect vector numbers. (A) Relative expression of phytoplasma in E. paraparvipenis and C. acuminata at different insect inoculation. (B) Pathogen transmission ability of E. paraparvipenis in different insect numbers. Each treatment was repeated three times.

Transmission effects of different stages of insect vector

Leafhopper at different ages (1–5 instar nymphs, female and male adults) were fed on healthy C. acuminata plants for 3 days, and the incidence rate of C. acuminata was checked after 10 days, which was 88.88, 66.67, 100.00, 77.77, 55.55, 11.11, and 0%, respectively. Phytoplasma detection showed that there were amplified bands in leafhoppers at each instar. The band size was single (fig. 5A), while the leaves of C. acuminata fed by all stages had about 1200 bp amplification bands except for males (fig. 5B). The detection of phytoplasma in the leafhoppers and leaves of C. acuminata showed positive amplification except for the none of the amplification of the leaves fed by male adults (15 < Ct < 35) (fig. S4AB).

Figure 5. Gel electrophoresis of phytoplasma: (A) in E. paraparvipenis at different ages (M: marker; 1: positive control; 2: 1st instar; 3: 2nd instar; 4: 3rd instar; 5: 4th instar; 6: 5th instar; 7: female adults; 8: male adults; 9: negative control); (B) in leaves of C. acuminata at different ages vaccination (M: marker; 1: positive control; 2–4: 1st instar nymphs; 5–7: 2nd instar nymphs; 8–10: 3rd instar nymphs; 11–13: 4th instar nymphs; 14–16: 5th instar nymphs; 17–19: female adults; 20–22: male adults; 23: negative control).

The amplified Ct values of phytoplasma in different stages (1–5 instar nymphs, female adults and male adults) of leafhopper were 23.46, 22.06, 21.68, 22.12, 23.87, 24.95, and 27.38, respectively. The phytoplasma amplified Ct values in the leaves of C. acuminata were 24.20, 23.43, 22.21, 22.26, 23.38, 23.95, and 34.36, respectively (table 2). It shows that the green leafhopper can acquire phytoplasma and transfer it from the first instar nymph to the male adult. The amount of phytoplasma expression in leafhoppers and plants and the pathogen transmission ability of leafhoppers at different stages were as follows: 3rd age > 4th age > 2nd age > 1st age > 5th age > female adult > male adult. The shortest (feeding by the third-instar nymph) and longest (feeding by the female adult) times for showing symptoms in C. acuminata were 3 and 6 days, respectively, indicating that the strength of the transmission ability determines the concentration of phytoplasma, which then determines the process of plant infection from phytoplasma to symptoms.

Table 2. Pathogen transmission effects of different development ages of Empoasca paraparvipenis

Note: Each treatment was repeated three times and the means were subjected to Duncan's multiple range test at P ≤ 0.05. Different letters showed significant differences.

Effects of Camptotheca acuminata phytoplasma on the life parameters of its insect vectors

There were significant differences in the development duration of adults and nymphs between the infected and the healthy leafhoppers at 20, 25, 28, 30, and 31.5°C (P < 0.05). At different temperatures, the development duration of the infected nymphs was significantly shorter than that of the healthy ones, while the development duration of the infected adults was significantly longer than that of the healthy ones (fig. 6A). Above 25°C, the development duration of the first, second and third instars with pathogen was significantly shorter than healthy ones, while the fourth and fifth instars, female and male adults, and pre-oviposition period with pathogen were significantly longer than those of the healthy leafhoppers (fig 6BC).

Figure 6. Development times of leafhoppers E. paraparvipenis. (A) Infected and healthy stages of insects. Different letters indicate the statistical difference among the column (P ≤ 0.05). (B) 1–3 instar nymphs of the infected and healthy insects. (C) 4th instars, adults and pre-oviposition periods of the infected and healthy insects.

Effects on progeny populations of vectors

The statistical data revealed that the progeny populations of the highly pathogenic leafhoppers and the healthy leafhoppers had significantly different life parameters after surviving on the highly pathogenic C. acuminata and the healthy C. acuminata at 28°C (P < 0.05). The leafhoppers on the healthy C. acuminata plants (B1) have the longest growth time, whereas the susceptible C. acuminata (A2) has the shortest (table S1).

Discussion

The potential significance of many insect vectors identified as a new carrier of pathogens must be considered for their growing abundance in a different host and their developmental cycle. Many phytophagous insects, such as the brown planthopper, black-tailed leafhopper, and white-backed planthopper, are monophagous or oligophagous and can only feed on one or a few plant genera gradually as the number of leafhoppers increases, and it was directly proportional to the leafhopper population. Due to more frequent feeding activities, the higher concentration of phytoplasma in plants and the higher transmission efficiency were recorded. The investigation of several leafhopper stages revealed that nymphs show higher transmission than adults. This could be because nymphs (1–4th instars) are more involved in feeding and moulting activities to grow and survive. The third-instar nymph has the best transmission ability because of its higher survival and frequent feeding activities. In contrast, the fourth-instar nymph exhibited higher survival, but its feeding activity was relatively weak in the latter stage due to the sex differentiation process. Female adults die a few days after oviposition, so there were fewer feeding activities; male adults, on the other hand, die after mating for a few days after emergence and do not eat, so their ability to spread pathogens was nearly minimal.

Plant pathogens are mostly transmitted by specific insect vectors, such as rice stripe mosaic virus (RSMV) is transmitted by leafhoppers (Sun et al., Reference Sun, Dongsheng and Ping2017), and papaya ringspot virus is transmitted by peach, cotton, and bean aphids. The pathogen directly affects the biological characteristics of insects (Agasyeva et al., Reference Agasyeva, Ismailov, Petrishcheva and Nastasiy2024), such as survival rate, egg production, reproductive duration, feeding behaviour, and host selection behaviour. It has an indirect effect on the ecological adaptability of insect vectors to host plants (Yan, Reference Yan2020). It was found that the leafhopper's growth, development, and reproduction were adversely affected after it became the vector of RSMV (Li et al., Reference Li, Jie and Yue2020). Several studies showed that most viruses promote the egg production of insect vectors (Carr et al., Reference Carr, Donnelly, Tungadi, Murphy, Jiang, Bravo-Cazar, Yoon, Cunniffe, Glover and Gilligan2018), whereas the infection of tomato spotted wilt virus reduces egg production in thrips (Zhu et al., Reference Zhu, Zhang and Lu2011). The oviposition selection of insect vectors is also indirectly affected by plants, and insect vectors tend to lay eggs on healthy or infected plants (Wan et al., Reference Wan, Hussain, Merchant, Xu, Xie, Wang, Zhang, Zhou and Wu2020).

Interestingly, here we found that the leafhoppers E. paraparvipenis feed on an emerging vector host C. acuminata tree, which is not surprising due to growing climatic conditions, environmental factors, and pathogen–vector evolution to occupy diverse hosts as well as biology of the vector and the phytoplasma. The impact of the phytoplasma of C. acuminata witches’ broom disease on the growth and development of the green leafhopper E. paraparvipenis at different temperatures were evaluated, as well as the life parameters of the infected and healthy leafhoppers using C. acuminata as its host plant. The results showed that with the increase in temperature, the development duration of both the infected and the healthy leafhoppers was significantly decreased, and the development duration of the first to third instars of the infected leafhoppers was shorter than that of healthy nymphs. However, the duration of the fourth and fifth instars, female, and male adults and pre-oviposition stage of the infected leafhoppers was significantly longer than that of the healthy leafhoppers.

An increasing number of emerging pathogens, new insect vectors for these pathogens and different vascular pathogens, including phytoplasma, result in devastating losses to agriculture. Due to rising climate change, there is a great evolution in the insect vector or pathogen, causing devastating losses to agriculture production. In the present study, different phytoplasma concentrations affect leafhopper life parameters differently. This revealed that C. acuminata phytoplasma is more conducive to green leafhopper survival and will increase the theirpopulation by decreasing the development time and increasing the number of female adults and eggs. Albeit, the molecular mechanisms for the new insect vector underlying this phenomenon are highly elusive and require in-depth investigation.

Supplementary material

The supplementary material for this article can be found at https://doi.org/10.1017/S0007485324000646

Acknowledgments

The work was supported by the National Natural Science Foundation of China (31960535).

Competing interests

None.

References

Abou-Jawdah, Y, Abdel Sater, A, Jawhari, M, Sobh, H, Abdul-Nour, H, Bianco, P, Molino Lova, M and Alma, A (2014) Asymmetrasca decedens (Cicadellidae, Typhlocybinae), a natural vector of ‘Candidatus Phytoplasma phoenicium’. Annals of Applied Biology 165, 395403.CrossRefGoogle Scholar
Agasyeva, IS, Ismailov, VY, Petrishcheva, M and Nastasiy, AS (2024) Use of biological agents to control the number of Halyomorpha halys Stål. Advancements in Life Sciences 11, 696702.CrossRefGoogle Scholar
Bertaccini, A, Fiore, N, Zamorano, A, Tiwari, AK and Rao, GP (2019) Molecular and serological approaches in detection of phytoplasmas in plants and insects. Phytoplasmas: Plant Pathogenic Bacteria-III: Genomics, Host Pathogen Interactions Diagnosis, 105136.CrossRefGoogle Scholar
Bosco, D and Tedeschi, R (2013) Insect vector transmission assays. In Dickinson, M and Hodgetts, J. (eds), Phytoplasma. Methods in Molecular Biology, vol 938. Totowa, NJ: Humana Press, pp. 7385.Google Scholar
Carr, JP, Donnelly, R, Tungadi, T, Murphy, AM, Jiang, S, Bravo-Cazar, A, Yoon, J-Y, Cunniffe, NJ, Glover, BJ and Gilligan, CA (2018) Viral manipulation of plant stress responses and host interactions with insects. Advances in virus Research 102, 177197.CrossRefGoogle ScholarPubMed
Dermastia, M (2019) Plant hormones in phytoplasma infected plants. Frontiers in Plant Science 10, 477.CrossRefGoogle ScholarPubMed
Hemmati, C, Nikooei, M, Al-Subhi, AM and Al-Sadi, AM (2021) History and current status of phytoplasma diseases in the Middle East. Biology 10, 226.CrossRefGoogle ScholarPubMed
Killiny, N and Almeida, RP (2014) Factors affecting the initial adhesion and retention of the plant pathogen Xylella fastidiosa in the foregut of an insect vector. Applied and Environmental Microbiology 80, 420426.CrossRefGoogle ScholarPubMed
Kumari, S, Nagendran, K, Rai, AB, Singh, B, Rao, GP and Bertaccini, A (2019) Global status of phytoplasma diseases in vegetable crops. Frontiers in Microbiology 10, 1349.CrossRefGoogle ScholarPubMed
Lee, IM (1993) Universal amplification and analysis of pathogen 16S rDNA for classification and identification of mycoplasma like organisms. Phytopathology 83, 834842.CrossRefGoogle Scholar
Li, P, Jie, Z and Yue, Y (2020) Effects of rice stripe mosaic virus on the growth, reproduction and feeding behavior of the mediator electric leafhopper. Acta Entomologica Sinica 2, 174180.Google Scholar
Marcone, C (2009) Movement of phytoplasmas and the development of disease in the plant. In Phytoplasmas: Genomes, Plant Hosts and Vectors. Wallingford: CABI International, pp. 114131.CrossRefGoogle Scholar
Marcone, C (2014) Molecular biology and pathogenicity of phytoplasmas. Annals of Applied Biology 165, 199221.CrossRefGoogle Scholar
Marzachì, C, Milne, RG and Bosco, D (2004) Phytoplasma-plant-vector relationships. Recent Research Developments in Plant Pathology 3, 211241.Google Scholar
Mou, D-F, Di Lella, B, Halbert, SE, Bextine, B, Helmick, EE and Bahder, BW (2022) Acquisition and transmission of the lethal bronzing phytoplasma by Haplaxius crudus using infected palm spear leaves and artificial feeding media. Phytopathology® 112, 20522061.CrossRefGoogle ScholarPubMed
Palermo, S, Arzone, A and Bosco, D (2001) Vector-pathogen-host plant relationships of chrysanthemum yellows (CY) phytoplasma and the vector leafhoppers Macrosteles quadripunctulatus and Euscelidius variegatus. Entomologia experimentalis et applicata 99, 347354.CrossRefGoogle Scholar
Quaglino, F, Sanna, F, Moussa, A, Faccincani, M, Passera, A, Casati, P, Bianco, PA and Mori, N (2019) Identification and ecology of alternative insect vectors of ‘Candidatus Phytoplasma solani’ to grapevine. Scientific Reports 9, 19522.CrossRefGoogle ScholarPubMed
Ranebennur, H, Rawat, K, Rao, A, Kumari, P, Chalam, VC, Meshram, N and Rao, GP (2022) Transmission efficiency of a ‘Candidatus Phytoplasma australasia’ (16SrII-D) related strain associated with sesame phyllody by dodder, grafting and leafhoppers. European Journal of Plant Pathology 164, 193208.CrossRefGoogle Scholar
Schmittgen, TD and Livak, KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nature Protocols 3, 11011108.CrossRefGoogle Scholar
Schneider, B, Ahrens, U, Kirkpatrick, B and SeemuLler, E (1993) Classification of plant-apthogenic mycoplasma-like organism using restriction-site analysis of PCR-amplified 16S rDNA. Microbiology-sgm 139, 519527. https://doi.org/10.1099/00221287-139-3-519Google Scholar
Sun, X, Dongsheng, J and Ping, Z (2017) Infection of rice stripe mosaic virus in the mediator electronic-leaf cicada. Chinese Society of Plant Pathology (Abstract), 285287.Google Scholar
Trivellone, V, Cao, Y and Dietrich, CH (2022) Comparison of traditional and next-generation approaches for uncovering phytoplasma diversity, with discovery of new groups, subgroups and potential vectors. Biology 11, 977.CrossRefGoogle ScholarPubMed
Wan, Y, Hussain, S, Merchant, A, Xu, B, Xie, W, Wang, S, Zhang, Y, Zhou, X and Wu, Q (2020) Tomato spotted wilt orthotospovirus influences the reproduction of its insect vector, western flower thrips, Frankliniella occidentalis, to facilitate transmission. Pest Management Science 76, 24062414.CrossRefGoogle ScholarPubMed
Wang, Z (2018) Detection of Camptotheca acuminata mycoplasma and identification and verification of vector insect leafhopper. Master thesis. Yunnan Agricultural University.Google Scholar
Wang, C, Chien, Y, Liao, P, Chiu, Y, Chen, Y and Yang, J (2021a) First report of 16SrII-V phytoplasma associated with green manure soybean (Glycine max) in Taiwan. Plant Disease 105, 2012.CrossRefGoogle Scholar
Wang, Z, Yuan, E, Su, F, Wan, Q and Cai, H (2021b) Identification of Camptotheca acuminate witches-broom phytoplasma and TagMan-based fluorescence qPCR method for detection. Acta Phytopathologica Sinica 51, 429440.Google Scholar
Wang, Z-H, Wang, W-P, Yuan, E-P, Su, F, Mao, Q-Y, Wan, Q-L and Cai, H (2021c) Identification of Camptotheca acuminate witches’-broom Phytoplasma and Taq man-based fluorescence qPCR method for detection. Acta Phytopathologica 51, 429440.Google Scholar
Wei, W, Jiang, L and Depo, Y (2006) Camptotheca acuminata planting in limestone mountains and its comprehensive control of brown spot. Practical Forestry Technology 11, 911.Google Scholar
Xing, L (2004) Distribution status, medicinal value and development prospect of Camptotheca acuminata. Journal of Shaanxi Normal University 32, 6973.Google Scholar
Xu, X, Gang, X and Wanbin, M (2009) Control test of Camptotheca acuminata canker. Jiangsu Forestry Science and Technology 36, 4454.Google Scholar
Yan, F (2020) Plant pathogen-vector interaction: research progress and prospect. Journal of Insects 63, 123130.Google Scholar
Zhang, S, Shunli, C and Feiping, Z (2002) Study on the life table of natural populations of Camptotheca acuminata. Journal of Fujian Forestry University 2, 45.Google Scholar
Zhu, XJ, Zhang, ZJ and Lu, YB (2011) Effects of inoculation of host plants with tomato spotted wilt virus on populations of the western flower thrips, Frankliniella occidentalis (Pergande) (Thysanoptera: Thripidae). Acta Entomologica Sinica 54, 425431.Google Scholar
Figure 0

Figure 1. In vitro and in vivo symptoms of C. acuminata (AB in vivo symptoms; CD in vitro symptoms; B1 and D1 infected C. acuminata; B2 and D2 healthy C. acuminata).

Figure 1

Table 1. Pathogen transmission ability of Empoasca paraparvipenis during different time intervals

Figure 2

Figure 2. Pathogen-transmission ability of insect vector. Relative expression of phytoplasma in C. acuminata leaves in different pathogen transmission time and ability of E. paraparvipenis. Each treatment was repeated three times, and the means were subjected to Duncan's multiple range test at P ≤ 0.05. Different letters showed significant differences over time.

Figure 3

Figure 3. Gel electrophoresis of phytoplasma: (A) in different numbers of E. paraparvipenis (M: marker; 1: positive control; 2: 1 insect; 3: 3 insect; 4: 5 insect; 5: 10 insect; 6: 15 insect; 7: 20 insect; 8: negative control.); (B) in C. acuminata leaves at different amount inoculation (M: marker; 1, 12: positive control; 2–4: 1 insect; 5–7: 3 insect; 8–10: 5 insect; 11–13: 10 insect; 16–18: 15 insect; 19–21: 20 insect; 11, 22: negative control).

Figure 4

Figure 4. Regression analysis indicating transmission effects of different insect vector numbers. (A) Relative expression of phytoplasma in E. paraparvipenis and C. acuminata at different insect inoculation. (B) Pathogen transmission ability of E. paraparvipenis in different insect numbers. Each treatment was repeated three times.

Figure 5

Figure 5. Gel electrophoresis of phytoplasma: (A) in E. paraparvipenis at different ages (M: marker; 1: positive control; 2: 1st instar; 3: 2nd instar; 4: 3rd instar; 5: 4th instar; 6: 5th instar; 7: female adults; 8: male adults; 9: negative control); (B) in leaves of C. acuminata at different ages vaccination (M: marker; 1: positive control; 2–4: 1st instar nymphs; 5–7: 2nd instar nymphs; 8–10: 3rd instar nymphs; 11–13: 4th instar nymphs; 14–16: 5th instar nymphs; 17–19: female adults; 20–22: male adults; 23: negative control).

Figure 6

Table 2. Pathogen transmission effects of different development ages of Empoasca paraparvipenis

Figure 7

Figure 6. Development times of leafhoppers E. paraparvipenis. (A) Infected and healthy stages of insects. Different letters indicate the statistical difference among the column (P ≤ 0.05). (B) 1–3 instar nymphs of the infected and healthy insects. (C) 4th instars, adults and pre-oviposition periods of the infected and healthy insects.

Supplementary material: File

Cai et al. supplementary material

Cai et al. supplementary material
Download Cai et al. supplementary material(File)
File 1.4 MB