Taxonomic summary of Schyzocotyle (Cestoda: Bothriocephalidae) with a redescription of Schyzocotyle nayarensis (Malhotra, 1983) from India

Abstract

In this study, we use an integrative taxonomic approach to redescribe Schyzocotyle nayarensis (Malhotra, 1983) (Cestoda: Bothriocephalidae), based on newly collected specimens from the type-host Raiamas bola (Hamilton, 1822) (Cypriniformes: Danionidae) in Fulbari, Siliguri, West Bengal, India. The detailed morphological assessment, from whole mounts, histology and scanning electron microscopy, offers additional insights into the scolex structure, vitelline follicles, and egg morphology. Molecular data from this and previous studies corroborate the identity and systematics of S. nayarensis as a bothriocephalid closely related to the Asian Fish Tapeworm, Schyzocotyle acheilognathi (Yamaguti, 1934). This study elucidates the historical context and taxonomic ambiguities surrounding S. nayarensis, emphasizing the key role of the scolex in both generic and species identification. Amendments to the diagnosis of Schyzocotyle Akhmerov, 1960 are proposed. A differential diagnosis of the two valid species within the genus, namely S. acheilognathi and S. nayarensis, is also provided. An evaluation of the taxonomic status of Bothriocephalus teleostei Malhotra, 1984, and Capooria barilii Malhotra, 1985 suggests that they may be S. nayarensis. Finally, we posit that none of the ten species of Ptychobothrium Lönnberg, 1889 described from Indian freshwater teleosts belong to this genus but instead appear to be a mix of species belonging to Schyzocotyle, Senga Dollfus, 1934, and possibly even Proteocephalidae La Rue, 1911; all require further study based on newly collected, properly fixed specimens and an integrated taxonomic approach. Finally, future survey studies may reveal hidden diversity of Schyzocotyle species in Indian cyprinoids.

Introduction

The genus Schyzocotyle Akhmerov, 1960 (Cestoda: Bothriocephalidea) was originally proposed by Akhmerov (1960) for the type species, S. fluviatilis Akhmerov, 1960. Dubinina (1982) suppressed Schyzocotyle by synonymising its type and only species S. fluviatilis with Bothriocephalus acheilognathi Yamaguti, 1934. More recently, however, Brabec et al. (2015) resurrected Schyzocotyle, based on a molecular phylogenetic analysis of Bothriocephalidea Kuchta, Scholz, Brabec & Bray, 2008 that provided strong support for the genus. At present, Schyzocotyle comprises two species: the well-known Schyzocotyle acheilognathi (Yamaguti, 1934) as the type species and the lesser-known Schyzocotyle nayarensis (Malhotra, 1983) Brabec, Waeschenbach, Scholz, Littlewood & Kuchta, 2015, described from India (Brabec et al., 2015).

Schyzocotyle acheilognathi (the Asian Fish Tapeworm) has been reported on all continents except Antarctica, earning the distinction of being one of the most successful invasive helminths (Kuchta et al., 2018). The cosmopolitan distribution of this parasite highlights its ability to infect various fish hosts across different orders and families (Choudhury & Cole, 2011; Brabec et al., 2015; Kuchta et al., 2018).

Schyzocotyle nayarensis was described by Malhotra (1983) as Ptychobothrium nayarensis, from two cyprinoid hosts, trout barb, Barilius (= Raiamas) bola (Hamilton, 1822) (Danionidae), and snowtrout, Schizothorax richardsonii (Gray, 1832) (Cyprinidae), from the Pauri-Garhwal district, Uttarakhand, India. Kuchta & Scholz (2007) synonymised this species with Bothriocephalus (= Schyzocotyle) acheilognathi based on morphological similarities, a conclusion supported by Kuchta et al. (2008a), but without examining specimens. Several years later, Brabec et al. (2015) sequenced new tapeworm material from Raiamas bola in West Bengal, resurrected Schyzocotyle, and proposed a new combination, Schyzocotyle nayarensis, but without a morphological study.

Recognizing the need for an integrative taxonomic approach to the species composition of Schyzocotyle, we present the results of a comparative study of the two species of the genus using morphology and molecular analyses. In particular, the taxonomic status of S. nayarensis is critically evaluated and the species is redescribed based on freshly collected specimens from one of two original fish hosts, Raiamas bola, in West Bengal, India. Additionally, we discuss the taxonomic status of Bothriocephalus teleostei Malhotra, 1984, Capooria barilii Malhotra, 1985, and 10 species of Ptychobothrium Lönnberg, 1889, described from Indian freshwater fishes (Phad, 1983; Malhotra, 1984a, 1985; Wadhawan, 1985; Kadam, 1993; Ghosh, 2013; Deshmukh et al., 2015, 2016; Barshe, 2018; Bhure et al., 2019; Gaikwad, 2019; Nanware et al., 2019).

Materials and methods

Field study and sample collection

Tapeworms were collected from the intestine of Raiamas bola at Fulbari (Mahananda River basin) in Siliguri, West Bengal, India. Fresh fish were purchased from local fishermen. Live fish were killed by dorsal pithing (including spinal cord) and severing the spinal cord immediately behind the head. Fish were dissected 1 to 2 h after collection to avoid decomposition and ensure that fresh specimens were collected. Tapeworms were cleansed in 0.9% NaCl solution (saline). After separating a small portion (the posterior-most proglottids) of the worm and storing it in 100% molecular grade ethanol, the remaining (anterior) corresponding portion of the worms were placed in a Petri dish containing a small volume of saline and fixed by pouring hot (almost boiling) 4% formaldehyde solution over them (see Chervy, 2024). Some worms were directly placed in 100% molecular grade ethanol for further molecular study and few entire worms were fixed with hot 4% formaldehyde solution to get the full body measurements.

Preparation of specimens for morphological evaluation

Following fixation in formalin for two to three weeks, the tapeworms were transferred to 70% ethanol (for storage) and the remaining processes, i.e., staining and preparation of whole mounts, histological sections, and scanning electron microscopy (SEM), were accomplished. For permanent whole mounts, specimens were stained with Mayer’s hydrochloric carmine, dehydrated in an ascending ethanol series, cleared in eugenol (clove oil) and mounted on slides using Damar gum. For histological sections, the scolex and a few portions of the strobila were dehydrated, embedded in paraplast, sectioned (at a thickness of 5–7 μm) and stained with Weigert’s haematoxylin-eosin. Five scoleces, portions of the strobila and eggs were processed for SEM as follows: specimens were dehydrated through a graded ethanol series, transferred to hexamethyldisilazane (see Kuchta & Caira, 2010), dried in air, sputter-coated with gold (approximately 7–10 nm thick), and examined with a Zeiss Sigma-300 FE-SEM microscope. Eggs isolated from gravid proglottids in a Petri dish containing distilled water were measured and photographed. For observation and detailed line drawing of whole mounted specimens, an Olympus BX53F2 microscope with Nomarski interference contrast optics and a drawing attachment was used.

Scientific and common names of fish hosts follow Froese & Pauly (2024). The terminology of microtriches follows Chervy (2009). Morphometric characters of the scolex and apical disc resulted from the measurements taken from both the lateral and dorsoventral side. Abbreviations of the terms used in descriptions are as follows: n = number of measurements, L/W = length/width ratio, WA/LS = width of apical disc/length of scolex, WS/LS = width of scolex/length of scolex.

Prepared slides of the newly collected specimens were deposited in the following museum collections: Zoological Survey of India, Kolkata, India (ZSI) and Helminthological Collection of the Institute of Parasitology of the Biology Centre of the Czech Academy of Sciences, České Budějovice, Czech Republic (IPCAS) (see details in taxonomic summary under Results section).

Molecular study

Tapeworm tissue from four gravid worms, stored in 100% molecular-grade ethanol, was air-dried in 1.5 mL microcentrifuge tubes for 30–40 min to remove residual ethanol, following which genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen Inc., Valencia, CA) and the manufacturer’s protocol. The ITS-2 region of the rRNA gene array and the cytochrome c oxidase subunit 1 (COI) gene were partially amplified by polymerase chain reaction (PCR) from one and four samples, respectively. PCR reactions were performed on an Applied Biosystems Veriti thermal cycler (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA) using 0.25–0.5 μL of Ex Taq DNA polymerase (TaKaRa Bio USA, Inc., Mountain View, CA) in a total reaction volume of 50 μL containing 31.75 μL of nuclease free water (Qiagen, Inc.), 5 μL of extracted DNA as template, 2 μL each of forward and reverse primers at a concentration of 1 pmol/μL, 5 μL of 10X Ex Taq Buffer (Mg2+ plus) (TaKaRa Bio USA Inc.) and 4 μL (200 μM) of deoxynucleoside triphosphates (TaKaRa Bio USA Inc.). The following primers were used for amplification: For ITS-2, Proteo-1: 5′-CGGTGGATCACTCGGCTC-3′ (forward) and Proteo-2: 5′-TCCTCCGCTTATTGATATGC-3′ (reverse) (Škeříková et al., 2004), and for COI, JB3 (=2575 of Bowles et al., 1992): 5′–TTTTTTGGGCATCCTGAGGTTTAT-3′ (forward) and JB5 5′–TAAAGAAAGAACATAATGAAAATG–3′ (reverse) (Bowles et al., 1992; Derycke et al., 2005). The amplification protocol consisted of an initial denaturing cycle of 5 min at 94 ºC, 25–35 cycles of the following: 94 ºC for 30 sec, 54 ºC for 30 sec, 72 ºC for 1 min, and a final elongation at 72 ºC for 5 or 7 min. PCR products were purified with ExoSAP-IT Express PCR Product Cleanup (Affymetrix, Inc., Santa Clara, CA). Purified products were sent to MCLab (South San Francisco, CA), for automated Sanger sequencing. The PCR primers were used for sequencing.

The amplicon sequences were manually checked, edited for accuracy, trimmed in FinchTV (Geospiza Inc., Seattle, WA), and a consensus ITS-2 and COI partial sequences assembled in MEGA X (Kumar et al., 2018). The 672-bp-long partial ITS-2 sequence was aligned with four isolates of S. acheilognathi (DQ866997, DQ866995, AF362431, AF362430), one of Schyzocotyle nayarensis (KX060598) obtained from GenBank (www.ncbi.nlm.nih.gov) using Clustal W in MEGA X. Similarly, the four partial (321 bp long) COI sequences were aligned with COI sequences of S. acheilognathi (OM675718, PP210023, MG968746, MG968745, MG968744, KR780792), S. nayarensis (KR780829), Bothriocephalus scorpii (Müller, 1776) (KR780788) and B. claviceps (= Bothriocestus claviceps) (Goeze, 1782) (KR780818) downloaded from GenBank.

The sequences generated in this study were deposited in GenBank with the following accession numbers: ITS-2: PQ134488. COI: PQ134520, PQ134521, PQ134522, PQ134523.

Phylogenetic analysis

There were 321 positions in the final aligned COI sequence dataset. Phylogenetic trees were generated from this aligned COI dataset using the Maximum Likelihood method based on the GTR + G + I (General Time Reversal + G + I) model as implemented in MEGA X. GTR + G + I was determined to be the appropriate model by first analyzing the dataset for best fit using the algorithm implemented under ‘Test Model’ in MEGA X. Initial trees for the heuristic search were obtained using Neighbor-Joining and BioNJ algorithms to a matrix of pairwise distances estimated using the Maximum Composite Likelihood approach, and then selecting the topology with superior log likelihood value. A discrete Gamma distribution was used to model evolutionary rate differences among sites (four or five categories [+G]) and the rate variation model allowed for some sites to be evolutionarily invariable ([+I]). All sites were used for the analyses. Codon positions included were 1st + 2nd + 3rd + Noncoding. The resultant ML tree was rooted using the COI sequence of Bothriocephalus scorpii (KR780788) based on a previous phylogenetic analysis of bothriocephalidean tapeworms (Brabec et al., 2015).

Results

Morphological evaluation

Based on the newly collected specimen the species is redescribed here.

Bothriocephalidea Kuchta, Scholz, Brabec & Bray, 2008

Bothriocephalidae Blanchard, 1849

Schyzocotyle Akhmerov, 1960

Schyzocotyle nayarensis (Malhotra, 1983) Brabec, Waeschenbach, Scholz, Littlewood & Kuchta, 2015 (Figs. 1–4)

Figure 1. Line drawings of Schyzocotyle nayarensis from Raiamas bola, Fulbari, Siliguri, West Bengal, India (a–b, d–f). (a) Scolex, dorsoventral view; (b) frontal section of the scolex; (c) scolex, dorsoventral view of Schyzocotyle acheilognathi from Labeobarbus kimberleyensis, South Africa; (d) cross section of gravid proglottid, note individual muscle fibres forming small bundles; (e) mature proglottid, ventral view; (f) mature proglottid, dorsal view. *Denotes continuation of vitelline follicles. Abbreviations: ad, apical disc; b, bothria; c, cirrus; cs, cirrus-sac; e, egg; gp, gonopore; ilm, inner longitudinal musculature; mc, median column; Mg, Mehlis’ gland; ov, ovary; t, testes; up, uterine pore; us, uterine sac; ut, uterus; va, vagina; vd, vas deferens, vf, vitelline follicles.

Redescription (based on 30 specimens from Raiamas bola from West Bengal, India, including 10 specimens for SEM and five sectioned specimens; measurements in micrometres unless otherwise stated. Measurements of Malhotra (1983) are given in brackets): Strobila up to 91 mm (n = 5) long [12–27 mm] with numerous acraspedote proglottids, up to 1800 (n = 5) wide [1131]. Proglottids usually wider than long, variable in size. Immature proglottids without primordia of genital organs numerous. Mature proglottids few in number, 281–531 [208–517] long by 969–1613 [924–1631] wide, L/W = 1:1.4–5.2 (n = 15); gravid proglottids vary in number (9–140) in different worms, 333–833 [216–650] long by 700–1800 [443–1605] wide, L/W = 1:1.3–4.3 (n = 200).

Inner longitudinal musculature well developed, formed by numerous bundles of muscle fibres (Fig. 1d). Surface of first proglottids covered with capilliform filitriches (Fig. 2c). Several pairs of osmoregulatory canal (Fig. 3a); canals difficult to see in mature and gravid proglottids. Ventral canals wide, thin-walled, usually in two pairs crossing testicular fields, slightly sinuous. Dorsal canals usually in two pairs, with median canals wide, thin-walled and more lateral canals narrow, thick-walled, sinuous. One pair of thin-walled lateral canals at level of lateral-most vitelline follicles. Canals may anastomose.

Figure 2. Schyzocotyle nayarensis from Raiamas bola, Fulbari, Siliguri, West Bengal, India. SEM (a–j); light microscopy (k). (a) sublateral view of scolex; (b) detail of capilliform filitriches on the scolex; (c) detail of capilliform filitriches on first proglottid; (d) detail of coniform spinitriches on the scolex; (e) gravid proglottid, dorsal view, note gonopore; (f) gravid proglottid, ventral view, note uterine pore; (g) detail of gonopore; (h) detail of uterine pore; (i) egg, note operculum; (j) detail of operculum; (k) egg liberated to water, note no embryo. Abbreviation: op, operculum.

Figure 3. Line drawings of Schyzocotyle nayarensis from Raiamas bola, Fulbari, Siliguri, West Bengal, India. (a) Immature proglottid, dorsal view, with distribution of osmoregulatory canals; (b) detail of genitalia; (c, d) gravid proglottid, ventral view, (c) without distribution of vitelline follicles, (d) with distribution of vitelline follicles. *Denotes continuation of vitelline follicles. Abbreviations: cs, cirrus-sac; doc, dorsal osmoregulatory canal; gp, gonopore; loc, lateral osmoregulatory canal; Mg, Mehlis’ gland; up, uterine pore; us, uterine sac; va, vagina; voc, ventral osmoregulatory canal.

Scolex lanceolate (arrowhead-shaped), with weakly developed apical disc (Figs 1a, 2a & 4a), 963–1600 [652–1250] long by 831–1540 [434–1241] wide; L/W = 1:0.82–1.06 (n = 17). Apical disc 131–194 [156–234] long by 213–388 [221–377] wide, occupies 20–30% width of scolex (n = 17) (Fig. 4c). Bothria deep, narrow, with simple non-crenulated margins, 775–1414 [403–980] long by 306–622 [91–500] deep; L/W = 1:0.35–0.57 (n = 32) (Figs 1b, 2a & 4b, d). ‘Median column’, structure between two bothria, uniform in width with slightly enlarged anterior end (Fig. 1a, b). Surface of scolex covered with coniform spinitriches and capilliform filitriches (Fig. 2b, d). Neck absent; width of strobila (‘peduncle’) immediately posterior to scolex 148–201.

Figure 4. Scanning electron micrographs. (a–d) different views of scoleces of Schyzocotyle nayarensis, collected from Raiamas bola in Fulbari (Mahananda River basin), Siliguri, West Bengal, India, fixed with hot 4% formaldehyde solution; (e–h) different views of scoleces of Schyzocotyle acheilognathi, collected from Gila cypha (e, f, h) and Cyprinus carpio (g) in the Little Colorado River, Grand Canyon, Arizona, fixed with hot 4% formaldehyde solution.

Testes medullary, in two lateral fields, almost spherical, larger than vitelline follicles, 19–50 [26–79] in diameter (n = 100), 70–170 [52–78] in number per proglottid (n = 23), absent medially and near lateral margins, confluent between proglottids (Figs 1e, f & 3a, c). Cirrus-sac spherical, muscular, thick-walled, anterior to ovary, 94–144 [50–343] long by 69–94 [40–165] wide, length/ width ratio 1.25–1.75 (n = 15), slightly pre-equatorial, equatorial to slightly post-equatorial; cirrus unarmed (Figs 1e, f & 3b). Internal seminal vesicle present, Vas deferens forms numerous loops anterolateral to cirrus-sac. Gonopore dorsal, median, slightly post-equatorial to almost equatorial (Figs 1f, 2e, g & 3b).

Ovary asymmetrical, median, lateral arms are formed by individual grape-like lobes, bilobed, usually at distance from posterior margin of proglottids, 131–213 [12–156] long by 219–400 [105–273] wide, representing 36–56% of length of proglottids and 22–30% of width of proglottids (n = 15) (Figs 1e, f & 3c). Vagina a straight, thick-walled tube, opens posterior to cirrus-sac into common gonopore; vaginal sphincter absent (Fig. 3b). Vitelline follicles numerous, small, mostly spherical, 16–25 [9–76 × 10–99] (n = 100) in diameter, almost circumcortical, missing medially in most uterine region, confluent between proglottids (Figs 1d–f & 3d).

Uterine duct sinuous, forms numerous tightly coiled loops, filled with eggs, enlarged in gravid proglottids. Uterine sac near anterior margin of proglottids, slightly submedian, alternating irregularly in position, thick-walled, spherical to transversely oval, enlarged in gravid proglottids to occupy large part of proglottids. Uterine pore submedian to median, thin-walled, open near anterior margin of proglottids (Figs 1e, 2f, h & 3c). Eggs operculate, unembryonated, 42–47 [10–49] long by 31–34 [10–46] wide (n = 52) (Fig. 2i–k).

Taxonomic summary

Synonyms: Ptychobothrium nayarensis Malhotra, 1983; Bothriocephalus teleostei Malhotra, 1984; Capooria barilii Malhotra, 1985

Unavailable names: Ptychobothrium tetraodoni Ghosh, 2013; Ptychobothrium bariliusi Ghosh, 2013

Type host: Not specified; first listed Raiamas bola (Hamilton, 1822), followed by Schizothorax richardsonii (Gray, 1832).

Additional host (tentative): Tetraodon (= Leiodon) cutcutia (Hamilton, 1822), Puntius (= Systomus) sarana (Hamilton, 1822). In addition, Bothriocephalus teleostei, which is considered a synonym of S. nayarensis, has been reported by Malhotra (1984b, 1989), Malhotra & Chauhan (1984) and Chauhan & Malhotra (1984, 1986) from other cyprinoids such as Barilius (= Opsarius) bendelisis (Hamilton, 1807), Garra gotyla gotyla (= Garra gotyla) (Gray, 1830), Labeo (= Bangana) dero (Hamilton, 1822), Labeo rohita (Hamilton, 1822), Labeo dyocheilus (McClelland, 1839), Schizothorax plagiostomus Heckel, 1838 and Tor tor (Hamilton, 1822). However, none of these reports contain morphological description of the cestodes found, and voucher specimens were never deposited.

Type locality: Nayar River (East and West), Pauri Garhwal, Uttarakhand, India.

Other localities: Fulbari Dam Lake, south of Siliguri, West Bengal, India; Bongaon, North 24-Parganas, West Bengal, India; Mynaguri, West Bengal, India; Bodh Gaya, Bihar, India.

Distribution: India (Bihar, Uttarakhand, and West Bengal). It is possible that S. nayarensis occurs in Schizothorax spp. outside India in the countries in which bothriocephalid tapeworms have been reported from snowtrout (Schizothorax), such as China, Pakistan, Tajikistan and Uzbekistan (see references in Kuchta et al., 2018). However, none of these reports contain morphological data, including illustrations of the tapeworms found, that would allow reliable identification of bothriocephalid tapeworms in these fish. Therefore, we only considered those specimens for which morphological descriptions were available.

Type material: Allegedly deposited in Parasitology Laboratory, Department of Zoology, University of Garhwal, Srinagar (Garhwal) 246 174 (slide no. PCLS 041/81 according to Malhotra, 1983). This type specimen could not be located and almost certainly does not exist. To facilitate further comparative taxonomic studies and to avoid confusion, a complete specimen from Raiamas bola collected from the Fulbari (Mahananda River basin) in Siliguri, West Bengal, India (Field No. NBF-19-397c) is designated as a neotype (ZSI/W11621/1).

Deposition of new specimens: ZSI (ZSI/W11621/1–ZSI/W11625/1), IPCAS (IPCAS C-695).

Prevalence and intensity of infection: A total of 13 Raiamas bola were examined; among them 11 fish were found infected with 125 S. nayarensis, overall prevalence 85% and the mean intensity of infection 11.4 (4–27 worms/host) (see Table 1 for data on infection rate).

Table 1. Prevalence and intensity of infection in Fulbari (Mahananda River basin), Siliguri, West Bengal, India

DNA sequences: The 672-bp partial ITS-2 sequence and four partial (321-bp long) COI sequences generated in this study is being deposited in GenBank with the following accession numbers: ITS-2: PQ134488. COI: PQ134520, PQ134521, PQ134522, PQ134523.

Molecular study

The 672-bp long partial ITS-2 sequence generated in this study is identical to the ITS-2 sequence of S. nayarensis (KX060598), previously obtained by Brabec et al. (2016). The ML tree generated from the phylogenetic analysis of the COI dataset shows all four isolates of S. nayarensis used in this study forming a strongly supported clade with the previously sequenced isolate of S. nayarensis (KR780829), distinct from S. acheilognathi (Fig. 5).

Figure 5. Phylogenetic tree from the ML analysis of the COI sequence data, based on the GTR+G+I model. The bootstrap nodal support (1000 replicates) is shown next to the branch. Branches with nodal support values <40 have been collapsed. The taxon name is followed by the isolate code, fish host, region/country of origin and the GenBank accession number.

Remarks

Malhotra (1983) described Ptychobothrium nayarensis from Pauri-Garhwal, Uttarakhand, India. The original description was based on specimens that appeared contracted and deformed due to fixation under pressure, as obvious from figures 1–4 in Malhotra (1983). Despite limited similarities to P. belones (Dujardin, 1845), the type species of the genus, Malhotra (1983) placed his taxon within Ptychobothrium, a genus of marine cestodes (Kuchta et al., 2008a; Kuchta & Scholz, 2017). Subsequently, Kuchta & Scholz (2007) synonymized P. nayarensis along with 13 other taxa described from freshwater fishes, with Bothriocephalus acheilognathi (= Schyzocotyle acheilognathi) based on their overall resemblance. However, these studies did not include molecular data or examination of specimens, which were never available on request to the authors of individual species.

Brabec et al. (2015) resurrected the genus Schyzocotyle Akhmerov, 1960 to accommodate Bothriocephalus acheilognathi based on molecular data. Additionally, they transferred Ptychobothrium nayarensis to Schyzocotyle but this decision was mainly based on molecular analysis of fresh samples collected from Barilius sp. (in fact Raiamas bola) in Fulbari, West Bengal, India. The taxonomic change was reiterated by Kuchta & Scholz (2017). However, it is worth noting that Brabec et al. (2015) did not discuss morphological similarities between their specimen and Malhotra’s (1983) Ptychobothrium nayarensis, nor did they propose morphological characteristics to distinguish between S. acheilognathi and S. nayarensis.

It is important to mention that although S. acheilognathi has been reported globally, including in India (Chaudhary et al., 2015), S. nayarensis has only been identified in two Indian cyprinoids (with potentially two additional hosts pending further investigation). Apart from variations in host range and geographical distribution, several morphological features distinguish these two species. A comprehensive differential diagnosis between these two valid species of the genus Schyzocotyle is outlined below: (i) arrow-shaped scolex in S. nayarensis vs heart-shaped scolex in S. acheilognathi; WA/LS = 0.22–0.29, WS/LS = 0.82–1.04 in S. nayarensis vs WA/LS = 0.36–0.39, WS/LS = 0.88–1.10 in S. acheilognathi (Fig. 4a vs Fig. 4e & Fig. 1a vs Fig. 1c); (ii) ‘median column’ uniform in width with slightly enlarged anterior portion in S. nayarensis vs median ‘column’ narrowest in the middle, widening distally and proximally with the more widened anterior portion in S. acheilognathi (Fig. 1a vs Fig. 1c); (iii) comparatively narrower apical disc in S. nayarensis (20–30% of scolex width) than that of S. acheilognathi (30–40% of scolex width) (Fig. 4a vs 4e, Fig. 4b vs Fig. 4f, Fig. 4c vs Fig. 4g & Fig. 4d vs Fig. 4h); (iv) more testes per proglottid in S. nayarensis (70–170, n = 23) compared to S. acheilognathi (26–86, n = 23) (see Table 2 for detailed comparison of S. acheilognathi and S. nayarensis).

Table 2. Differences between the species of Schyzocotyle Akhmerov, 1960

^* Measurements of S. acheilognathi are adapted from Scholz (1997).

^† Measurements of S. nayarensis from Raiamas bola are portrayed in the present study.

Differential features in bold. Abbreviations: L, Length; W, Width.

The molecular characterization in this study demonstrates that the studied worms are the same species as the specimen studied by Brabec et al. (2015, 2016) from Fulbari, India. Regrettably, it seems that the type material of Ptychobothrium nayarensis may no longer be available, and attempts to obtain it through written or personal communication with the author have been unsuccessful. Furthermore, in addition to sharing the same host species, significant similarities in key morphological features have been observed between our specimen and P. nayarensis (Malhotra, 1983). These include the uniform width of the median column (refer to Fig. 1a of present study and Fig. 1 of Malhotra, 1983), similar apical disc (which notably differs from those found in recognized species of Ptychobothrium; compare Fig. 1a of present study and Fig. 1 of Malhotra, 1983 with Fig. A of Deshmukh & Shinde, 1975, and Fig. 1B of Châari & Neifar, 2022), and consistent cross-sectional profile (see Fig. 1d of present study and Fig. 5 of Malhotra, 1983). These resemblances lead us to conclude that the worms studied by Brabec et al. (2015, 2016) and by us (this study) are the same as Malhotra’s (1983) P. nayarensis (= S. nayarensis).

Malhotra’s (1983) description of the scolex structure lacked detailed mention of the apical disc and bothria. However, SEM observations in this study reveal a weakly developed apical disc and narrow (slit-like), deep bothria with non-crenulate margins. Detailed characterization of bothria is crucial for accurate generic diagnosis and serves as a key distinguishing feature between the two genera, Ptychobothrium and Schyzocotyle (see Kuchta et al., 2008a; Brabec et al., 2015 for more information). An intriguing discovery in our study is the presence of circumcortical vitelline follicles surrounding the medullary testes from both sides, a feature not explicitly mentioned in Malhotra’s (1983) description, which only referred to cortical vitelline follicles. However, in bothriocephalids, “cortical” might also imply circumcortical. Additionally, we provide for the first time for this species details of the egg structure through both light and scanning electron microscopy and confirm the presence of unembryonated eggs, which do not match the description provided by Malhotra (1983) (embryonated with measurement of oncosphere).

The following morphological characteristics of Schyzocotyle distinguish it from Ptychobothrium: i) heart- or arrow-shaped scolex (as opposed to sagittiform to fan-shaped in Ptychobothrium), ii) bothria exhibiting non-crenulated margins (as opposed to slightly crenulated internal margins in Ptychobothrium), iii) circumcortical vitelline follicles (contrasting with the medullary arrangement in Ptychobothrium) [Malhotra, 1983 referred to cortical vitelline follicles; see Fig. 1d of the present study], iv) operculate eggs, unembryonated (versus non-operculate, embryonated eggs in Ptychobothrium) [Malhotra, 1983 mentioned operculate eggs; see Fig 2i–k of the present study] (see Kuchta et al., 2008a; Brabec et al., 2015 for further details).

Lönnberg (1889) established the genus Ptychobothrium within the family Ptychobothriidae Lühe, 1902, in the order Pseudophyllidea, to redefine Bothriocephalus belones Dujardin, 1845 as Ptychobothrium belones (Dujardin, 1845), originally found in garfish, Belone belone (Linnaeus, 1761). Currently, the genus Ptychobothrium comprises two valid species, P. belones (Dujardin, 1845) and P. ratnagiriensis Deshmukh & Shinde, 1975, exclusively found in marine fishes (Deshmukh & Shinde, 1975; Kuchta et al., 2008a; Châari & Neifar, 2022).

List of taxa with questionable taxonomic status

Bothriocephalus teleostei Malhotra, 1984, originally described from Barilius (= Raiamas) bola and Schizothorax richardsonii, as well as Capooria barilii Malhotra, 1985, described from the same fish host (Raiamas bola), are now considered synonyms of S. nayarensis because of their striking similarity. A comprehensive analysis of their status is provided later. Furthermore, the taxonomic status of several other bothriocephalidean cestodes, initially proposed as synonyms of Bothriocephalus (= Schyzocotyle) acheilognathi by Kuchta & Scholz (2007), has been re-evaluated. This re-evaluation involves a critical comparison of their diagnostic features with those of S. acheilognathi and S. nayarensis. The updated taxonomic designations of these taxa are summarized in Table 3.

Table 3. List of bothriocephalidean cestodes considered morphologically indistinguishable from the species of the genus Schyzocotyle Akhmerov, 1960. Species are listed chronologically according to genera (newly assigned or changed taxonomic designations resulting from the present study are marked in bold).

^a Morphologically indistinguishable from Schyzocotyle acheilognathi

^b Morphologically indistinguishable from Schyzocotyle nayarensis

^$ Type host (if more than one host documented and type host mentioned in the original description)

^# Brabec et al. (2015)

¹ Yeh (1955)

² Pool & Chubb (1985)

³ Körting (1975)

⁴ Pool (1987)

⁵ Molnár (1977)

⁶ Kuchta & Scholz (2007)

* Caira et al. (2024)

⁷ Dubinina (1982)

Several other species of Ptychobothrium, such as Ptychobothrium pangaonensis Phad, 1983; P. bilaspurense Wadhawan, 1985; P. osmanabadensis Kadam, 1993; P. tetraodoni Ghosh, 2013; P. bariliusi Ghosh, 2013; and P. ovalum Gaikwad, 2019, were originally described in unpublished PhD theses, rendering these specific names unavailable according to the Articles 8, 10, 11 of the International Code of Zoological Nomenclature (1999, 2012). Majority of these descriptions suffer from various defficiencies, including improperly fixed specimens, inadequate line drawings, and a lack of type materials, which are significant issues (for further details, see Phad, 1983; Wadhawan, 1985; Kadam, 1993; Ghosh, 2013; and Gaikwad, 2019).

Furthermore, Ptychobothrium pangaonensis, described from 15 specimens collected from Nemacheilus (= Acanthocobitis) botia (Hamilton, 1822) in the Rena River at Pangaon, Taluka Ambajogai (Beed), Maharashtra, India, shares numerous morphological characters with S. acheilognathi, such as the shape and size of the scolex, the size of mature and gravid proglottids, and the size of the testes. Similarly, P. bilaspurense found in the intestine of Eutropiichthys vacha (Hamilton, 1822) from a tributary of Gobind Sagar Lake, Bilaspur, Punjab, India, also exhibit morphological similarities with S. acheilognathi, including the shape and width of the scolex, the size of mature and gravid proglottids, the number and size of testes, and the size of eggs. Likewise, P. osmanabadensis (described based on four specimens) collected from Chela (= Salmostoma) phulo (Hamilton, 1822) at Jakekur, Taluka Omegra, District Osmanabad, Maharashtra, India, again demonstrates striking similarities with S. acheilognathi in scolex shape, scolex length, neck width, and the size and number of testes. Consequently, all of these species are considered conspecific with S. acheilognathi (see Table 3).

Similarly, Ptychobothrium tetraodoni, described from Tetraodon (= Leiodon) cutcutia and Barilius (= Raiamas) bola from Bongaon, North 24-Parganas, West Bengal, India, and Mynaguri, West Bengal, India, respectively, and P. bariliusi from Puntius (= Systomus) sarana and Barilius (= Raiamas) bola from Bodh Gaya, Bihar, India, were documented by Ghosh (2013) in her unpublished PhD thesis. Various inconsistencies are observed in these descriptions, including immature proglottids exhibiting a greater width compared to mature ones, possibly due to inadequate fixation, as immature proglottids possess a higher density of muscle fibres (see description of P. tetraodoni by Ghosh, 2013). Similarly, discrepancies in the number of testes between the description and figures are also noted (see Ghosh, 2013). Additionally, apart from sharing the same host Raiamas bola, P. tetraodoni and P. bariliusi share several other characters with Schyzocotyle nayarensis, including shape of the scolex and median column (see Figs. 7a and 8a in Ghosh, 2013), number of testes (see Figs. 7c and 8a in Ghosh, 2013), and their distribution. Based on these observations, they are also considered conspecific with S. nayarensis (see Table 3).

In contrast, Ptychobothrium ovalum, described from Mystus (= Sperata) seenghala (Sykes, 1839) in Dharmabad, Umari District Nanded, Maharashtra, India, exhibits notable resemblance in morphological traits, particularly in the arrangement of vitelline follicles, with proteocephalid tapeworms, in particular species of Gangesia Woodland, 1924 (see Ash et al., 2012, 2015). Ptychobothrium elongata Deshmukh, Nanware & Bhure, 2016, described from five worms from Mystus (= Sperata) seenghala in Dharmabad, District Nanded (Maharashtra), India, is actually a bothriocephalid because of the median, sacciform uterus (Fig. 2 in Deshmukh et al., 2016). Because no scolex was illustrated (“scolex” on Figs. 2 and 3 are actually immature proglottids), it is not possible to confirm generic assignment. The specimens appear to have been poorly fixed and improperly stained. Ptychobothrium vitellaris Deshmukh, Nanware & Bhure, 2015, based on seven specimens from Mastacembelus armatus (Lacepede, 1800) from Mahur, District Nanded (M.S.), India, shares significant resemblance with species of Senga Dollfus, 1934, as evidenced by illustrations, photomicrographs, and morphological descriptions, including scolex morphology (for more details, see Figs. 2 and 3 of Deshmukh et al., 2015). Similarly, P. follicularis Nanware, Gaikwad & Bhure, 2019, described from Channa punctata (Bloch, 1793) from Mahur, Hadgaon, district Nanded, Maharashtra, India (also described in an unpublished PhD thesis as P. follicularis Gaikwad, 2019), and P. punctatum Bhure, Barshe & Nanware, 2019 (initially described in an unpublished PhD thesis [Barshe, 2018] as P. punctatum Barshe, 2018), described based on four specimens parasitizing Channa punctata from Ausa, District Latur, Maharashtra, India, show similarity in hosts and other morphological features, including scolex morphology (refer to Fig. 1 of Nanware et al., 2019; Bhure et al., 2019), which suggests that they are possibly species of Senga. Further investigation is necessary to confirm the taxonomic designation of the five aforementioned Ptychobothrium species (see Table 4).

Table 4. List of bothriocephalidean cestodes of the genus Ptychobothrium Lönnberg, 1889, morphologically indistinguishable from species of different genera other than Schyzocotyle Akhmerov, 1960

^a Morphologically indistinguishable from Senga sp.

^b Morphologically indistinguishable from Gangesia sp.

All taxonomic designations mentioned in this table are the result of the present study.

Discussion

Kuchta et al. (2008b) established the order Bothriocephalidea by reorganizing the previously paraphyletic order Pseudophyllidea van Beneden in Carus, 1863 into two distinct monophyletic clades: Diphyllobothriidea Kuchta, Scholz, Brabec & Bray, 2008, and Bothriocephalidea. This classification was based on a combination of unique biological traits (primarily life cycle characteristics and host range), morphological observations, and molecular analyses (Brabec et al., 2006; Kuchta et al., 2008b). The order Bothriocephalidea was initially divided into four families: Bothriocephalidae Blanchard, 1849; Echinophallidae Schumacher, 1914; Philobythiidae Campbell, 1977; and Triaenophoridae Lönnberg, 1889 (see Bray et al., 1994; Kuchta et al., 2008b), with distinctions based on the position of the gonopore (median, sublateral, or lateral). However, Kuchta & Scholz (2017) later suppressed the family Philobythiidae (Brabec et al., 2015; Kuchta & Scholz, 2017).

Our specimens exhibit all the diagnostic traits of Bothriocephalidae as described by Kuchta et al. (2008a) and correspond to Schyzocotyle as characterized by Brabec et al. (2015).

The present study allows us to amend the generic diagnosis of Schyzocotyle, which is characterized by the following features not mentioned explicitly in Brabec et al. (2015): (i) heart-shaped or arrow-shaped scolex; (ii) weakly developed apical disc; (iii) narrow, deep bothria without crenulated margins; all other generic characteristics remain consistent with those outlined in Brabec et al. (2015).

Schyzocotyle nayarensis has only been documented in two cyprinoids in India, namely Raiamas bola and Schizothorax richardsonii, with Leiodon cutcutia and Systomus sarana potentially identified as additional hosts pending further study. Raiamas bola, also known as trout barb or Indian trout, exhibits a potamodromous distribution across India, Bangladesh, Myanmar, Nepal, Bhutan, and Thailand (Froese & Pauly, 2024). So far, other than S. nayarensis, one Diplozoon species, namely Diplozoon dasashwamedhai Agarwal & Kumar, l989 and two nematodes, namely Contracaecum sp. and Camallanus barilii Gupta & Duggal, 1988 have been reported from this fish (Gibson et al., 2005).

Another host, Schizothorax richardsonii, is a demersal, freshwater, potamodromous fish found in various Asian countries, including the Himalayan region of India, Bhutan, Sikkim, Nepal, Pakistan, and Afghanistan (Froese & Pauly, 2024). In addition to S. nayarensis, the following parasites have been reported from this little cyprinid: one ciliate protist Ichthyophthirius multifiliis Fouquet, 1876; one cestode, Guptaia garhwalensis Malhotra, 1985 (species incertae sedis; see Caira et al., 2024); one polyopisthocotylan, Diplozoon poochensis Gupta, Gupta, Anjum & Gupta, 2014; several nematodes, Camallanus khalili Arya, 1989; Procamallanus guptae Arya, 1978, Spinitectus sp., Paracucullanellus schizothoraxi (Arya, 1983), Rhabdochona (Filochona) teleostei (Singh & Malik, 1992), Rhabdochona (Filochona) nayari Malhotra, Banerjee & Chaubey, 1990, Rhabdochona (Rhabdochona) himalayii (Singh & Malhotra, 1989); and two trematodes, Diplostomum tetrai Chopra, Kumar & Singh, 1983, Neascus vetestai Kaw, 1950 (Gibson et al., 2005; Gupta et al., 2014; Mallik et al., 2015; Singh & Panwar, 2020).

Malhotra (1983, 1984a, 1985) described three new cestode taxa, namely Ptychobothrium nayarensis, Bothriocephalus teleostei, and Capooria barilii, from the same fish host (Raiamas bola) and geographical area. Despite morphological similarity of all species, they were placed in three different families, i.e., Ptychobothriidae, Bothriocephalidae, and Diphyllobothriidae. Bray et al. (1994) considered Capooria described as a diphyllobothriid as a genus inquirendum because of its resemblance to members of the Bothriocephalidae. Kuchta & Scholz (2007) later synonymized P. nayarensis, B. teleostei, and C. barilii, and several Ptychobothrium species, with Bothriocephalus acheilognathi, based solely on morphological similarities. This action rendered Capooria a junior synonym of Bothriocephalus, a conclusion upheld by Kuchta et al. (2008a).

The present study focused on collecting fresh specimens of tapeworms from R. bola, the common host of P. nayarensis, B. teleostei, and C. barilii, as suggested by Malhotra et al. (2015). Although the rivers where the specimens were collected differ between our study and those referenced by Malhotra (1983, 1984a, 1985), both rivers originate in the Himalayan foothills, and show some similarities (Singh et al., 2023). In line with Malhotra et al.’s (2015) emphasis on certain salient features to confirm taxonomic status, our study includes SEM micrographs to highlight morphological details and transverse histological sections to illustrate the positioning of organs like the vitellarium. The circumcortical vitelline follicles observed in our specimen bear resemblance to those described in Malhotra’s work (1983, 1984a, 1985). While the scoleces of P. nayarensis, B. teleostei, and C. barilii appear different in Malhotra’s descriptions, the consistent width of the median column in all three aligns with a key diagnostic feature of S. nayarensis. Additionally, our study benefits from uniformly fixed samples using hot 4% formalin, in contrast to the fixation method used by Malhotra (1983, 1984a, 1985) (aqueous Bouin’s solution), which may result in unnatural variability (Pool & Chubb, 1985). Efforts to procure the type materials of P. nayarensis, B. teleostei, and C. barilii through written or verbal communication with the author have proven unsuccessful. Sampling in the original locations of those taxa was, logistically, not possible at this time. However, comparing our newly acquired material with the descriptions of the three tapeworms described by Malhotra, while taking into account the artifacts of fixation, we conclude that these all three taxa are conspecific and belong to S. nayarensis.

Conclusion

Kuchta et al. (2008b) highlighted several significant challenges in the study of bothriocephalideans, which have historically caused confusion in the study of these tapeworms. These obstacles include: low prevalence of bothriocephalidean cestodes in hosts, superficial morphological similarities among species, inadequate fixation of fresh biological samples, difficulty in observing the internal anatomy due to strobilar thickness, challenges in evaluating minute morphological details, paucity of deposited type material in museums, and absence of hologenophores. Among these issues, one major limitation of Malhotra’s (1983) study was the use of aqueous Bouin’s solution as a fixative, which has been demonstrated to cause anomalies in taxonomic descriptions in an experimental study by Pool & Chubb (1985). They showed how scoleces of the same species can appear distinctly different with the application of different fixation techniques (see also Chervy, 2024). The morphology of the scolex stands out as a critical aspect among bothriocephalidean cestodes, playing a pivotal role in genus identification (Kuchta & Scholz, 2017). At times, distinguishing between the scoleces of bothriocephalideans can be challenging due to their striking resemblance. However, even slight variations in scolex morphology, if not accurately discerned, can lead to significant confusion regarding their taxonomy and systematics, as evidenced by past studies of bothriocephalidean cestodes (Yamaguti, 1934; Akhmerov, 1960; Molnar, 1977; Dubinina, 1982; Scholz, 1997; Kuchta & Scholz, 2007; Kuchta et al., 2008a; Brabec et al., 2015; Kuchta & Scholz, 2017; Choudhury & Scholz, 2020), and exemplified by Schyzocotyle acheilognathi and S. nayarensis. We have addressed these challenges and attempted to rectify the gaps by redescribing S. nayarensis as accurately as possible. Furthermore, the discovery of several new cestode species such as Lobulovarium longiovatum Oros, Ash, Brabec, Kar & Scholz, 2012 in cypriniform fishes (Puntius spp.) in India and Bangladesh; Mystocestus anindoi Scholz, Biswas, Patra & Ash, 2022 from small bagrid catfishes (Mystus spp.) in West Bengal and Maharashtra; and Gangesia mukutmanipurensis Marick, Brabec, Choudhury, Scholz & Ash, 2023 from a silurid catfish, Ompok bimaculatus (Bloch, 1794), in West Bengal, indicates the importance of regularly examining different unexplored fish hosts using an integrative taxonomic approach. Such examinations may reveal many interesting parasites, including new representatives of the genus Schyzocotyle.